%PDF-1.5 % 1 0 obj <>>> endobj 2 0 obj <> endobj 3 0 obj <>/ExtGState<>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/Annots[ 16 0 R] /MediaBox[ 0 0 612 792] /Contents 4 0 R/Group<>/Tabs/S/StructParents 0>> endobj 4 0 obj <> stream x][o8~ `_܋,DivL`.04NڝߟEReYRcX,Jj}q(᰾x,~?nw8nsvz{>lwwgo?;wfYǧO-EUSo>ߋO;{V4e%OU+D]Ԫjz $?=+'db󊉓-yb5|Ov+^b>y2}jQ* r9)TLYaŹi7+&l`ʚ'EbVPOsM?OV\&d٦ /ځ TXc!r &PԀ4Xւ_H^~!(`,=\V_te^euOޯܽթ{NnV\/s e KSO)RBRBR)!3MK >Ւo+eU&eq"8 L!0Á-ޡ§x 6ynruC#RnW-ݺ^U)vI*2>O+9Yɀlo;1q *yUJny]0) n Rn(95~Q7Bng+Hjqx?nV:^hMB`n,lRU 3zKm^ZMA Njw4!_ٓFf+߮5Qߗ =soأwQBĻPㅬK7,d[°KQ«Vm> !/.p潿ߒʷ7mR×m6:T$[V6CEюI<Ȃx^>+4pPӮ7N^KFVx@ URlZAQ5HUPƳ2d}IπxӋ8{^~YTg?ﮋ߭E[ XM)  [X+LWӬ*}bb 5Kɉiw隑)&\oN5,^n],'A`NnVH+Ȃڊ !][7\%L#+,jb!f ~\M4GOJ>ihxPሼ d81&/v%יbκFLrlsO/)ޢp\trYvep1]1LEٟXd4:âAlфG?M^slظF8v2z\ªT/WfVY* x@ؔUf'3F`_PmIVBTVB WA܌IpLGz+aL0h8x3~q>t3Tz6mE+"]:4U Pc(r`l!ȓ(΍ JIKO|;2KvZCޖK)k7aԇ4u$Ҍܛ)ug,8+dF~A^Ape9} N_S3,7[!nE}a=:1F#bpEŘ,^lq 6>c(S?,gNv|2@ַv|‚C\L FIia"ډam٘EP$N#!.0DoVy_|2 ER$`a^cR:=m!LfZi9T<0xs@@L#ݨ uUHw}3$G#嗱!av\l:I k(G)Π{6SL .?S>dn˘34w2w"&gSA1ǖg6Fc~ ozE1]:dO 7DŎ|ȭ^5D tBpqK,6MD|D=jh4GNf>g.邋 UqљИp9Fi\,Y ]G 2dG+6ZNsWQcW9z\SmXDog XUx hLƥnTŖUvR%VqnY4l hO6TU N #ոϯS;MaJ^<.5%$Oxa^elO0Ig"֛ ojFلfd$p j}LlNNiuBD3^=Ks{u*ZFDF*Ϥjc+[C9!suNGTUW6$2h9VVy/GyX9?w>ɠ6G` s2}[Jƶu;e\VŢq3U`*x<$|>t F*7`XCsoUtGXT*}4/$e&&3Mt'7+U21Q9׷b;!:u$Ny#sQ%:IFCRC{ub@㜣g I/Ai_kͼTp9p:H*72XsGbLBMycd3qfU$5iܗ@>V`WX\gTTaC>`zѯhdfin)`͈T~cFs(# _(눼'LQ[u^6_U W!Q8# >6axܸ  g}TDS\T ƚn@>ъvcoR1$N#IShnq$/J7sŽ]@l\|p>zXkó$纝'Kk1)2M\hW>.I Tm oKEϱtǖ ck>iTL H#Aba%Bݢ{Wbb"5a+g ۜjn*W`qI4vP3L bSt/7 H)hL{1u~A-jǷA-3eӰ]^\-aZ@ <^"bFb5{ѧcllsuF8A,LN*9H1(v =a8Q]2YkR ׉ ƨ"f/lP}G1oD&v Æ .P{U?j)E)yc0k94ǫpZ^6yZ$VnCoj`閦΃9+J-5~)`H#H> ybjURGO ʠuZ~(#$Ώ=#hRK{n ^ endstream endobj 5 0 obj <> endobj 6 0 obj <> endobj 7 0 obj <> endobj 8 0 obj <> endobj 9 0 obj <> endobj 10 0 obj <> endobj 11 0 obj <> endobj 12 0 obj [ 13 0 R] endobj 13 0 obj <> endobj 14 0 obj <> endobj 15 0 obj <> endobj 16 0 obj <>/F 4/A<>>> endobj 17 0 obj <> endobj 18 0 obj <> endobj 19 0 obj <] /BitsPerComponent 1/Interpolate false/SMask 20 0 R/Length 2>> stream endstream endobj 20 0 obj <> stream xMy`tYmVA KG @^SYXSVH՜!fA$t݀3O'Ӊvt0hL'Ӊvt0hL'Ӊvt0hL'Ӊvt0hL'Ӊvt0hL'Ӊvt0hL'Ӊvf4w{oLE뼟ڀchvu/-n6x//.DhTz+Zw=ފO[4]h2n@ ǽ~O'LGsxWh|*m9$-t[y-yh(|O;::߉lWvm^kѦAj7B6ba59hj{͓V?q#݉6ODےmNy_֜h/EeiOJz'~֝h-Mt難x)wh,&DSB3[4K2;͈ӆۛ.Π{@}N4"47&?G;r lj~n4;JZ%n@{6ۣovA ˲{ڞc:dzZsUo_(vhBko@|"҉&ӉЮD[𻢵mzD;N4JO9֜h'ډFIdȀDfiF5X eh <ſiDo5]<ڊeCMج=6Md?Jqi;C+/|&@ J/ظDS^./|-fd !tr0uj#Z(/f:9,D?lY -DFe7APhZLϻ]]8FދAp8e0Kam؂'4jm,1hPNԸ hCf6AhM^;\v5D2ZC֘G[sЃ=h܉rЌԍ#Wyχ;78e@%8Gl-Њ|^9X{"jDfƵ3&4O/%ZjļqhиKMB Uy僒T;ȗrf$.m 'T1WLa:hЩEC4΄E4' *h֧ q9Zl??рݫNhOh%Vb|?I4h7<87<1Cs3IŶ9t/% ڕ^m{%B.5dh"]hlvDK?J4ͧ9lp}^O.ZOS#Ebw&&\nJ4ѩE4ʋЦqF1S+}ȫU61Sth~,Lv~j\x#B5ghQ byfivӈJ4ѩEAS/Ln!o/ŀF7s:bݹf#gSQUMJ$GectT ?2 *z%?eZDQ0ڐ A M#ڭlEz;u6q׵{FU7ʂljDI %4ka/QZx=F%|/BUЊ4UKE *H Zjh1`T7Ȃ ho mR4E=h.(Њ q14jh$6D[G`I] OĈkN\6wH-PMʼn@:ڔ^e(ZGht%4b*heBT K4YH4M!vđ߅"b p5Z%h%B+]5C6e P= dskQBr^". mPOMԣR}so]:!E(U&d 4~R-?J4ۊܕ-D:Ռhz -#mR4Tvq(%.{O#rVU%-3x8*66f_v)6eǕ9rNmLNк螌u*[ۇ&,К hIN,yV|ʓټ ͬٗfp CnAhShg&-]6?D+cM19-Yd?Ms'ڰǬ_JQMoCKh7%мt|˻N$&37-*Z+њFsFk7Ag#JOA B-謠]R &ѷ}hx-%ZЪd2޻hvmANmF~/sѦde|*⁏Csьh<O> ѨS+h0:4Um\4xNhhaހƝZG^4ƧԞ'gxbhz ZiѺD@ϯD[Fӻ =>{wj 5Шϡ?}!uD?E߶Gi++"CS_&:~"UAF| Zl碹/GZG_mZ|hԃn4\xShDӧ-G@i*PN= C'-FF4yZ.ZͬUv߀>h[iͮ뇏Ti=ܚ}hSjx#vZh)Rz2Z_MagDZF3h>TYFk+zR vnb4]MeJ9C̞ވ6Z)[Ѱhn#Z-_$وƽL@sDϣ5mTGS+s4#yעPzہƟh@U*ϡhI'τvSMGGh|yh@@^'I6V*e(iM,VK4+ şULŗݼ/C+G tP%h7UaO [ FnM3ZS Jzܺ63E[٩Ear>6p݇%_ MSu[Z aSWNqwZhj#hܩu4#7ۅ]\܄JW@peZuU2Vd#3i$, ڃOVMbf7Z[EKhtjpVO@%ZGֲ Mcc0A-f3p^98SUiƝZDj[ђC  w(qڀH=M7a@2%QNwAѨ:Xs/;gNpu t*ĸY@m=1fhS֏O dHBw49BP>t/b&>67dV<#v`*i&˿m8)0#f n0&mÀ^aMz$MJ/(_T榭ZDG4[}h}7A| ڄq h@AӜ_$ Q=B壀9bgDKG8@KZm - JeZDWSUpA1{Z3o_Cǐ[a?S֯R̘j>2;BVj `7@hJ$iy {Fd/kܩu4Mh[ICCk&L4Y@tLPv^rD㣶*Z-$\5?Z#B;BAv9Nh]cMq)zPtG uhFBh$v ;Ih@n|lB^H$+YOˀ-]xS(o3;uj / gۊvkEyW.FIKB Ѐ \8 ;\Dc7FBs}o"_X[zZjkak֩%4X&4pGhѼ…T֏ 1F~'JZE+ 4[IBp*ebn_C#;THhMG7ZR?|)|M3C(f% M{Y2Z%_&=BG( .p &{ѩ%4hi:mA&.CN Nh8oxfh-' hP@Rv񣞛0wAC- :\=^Es hCSKhP^7Bؾ!l34ًhc'Ÿbc a* v%aAP1hvMtj Jؾֈf$-- + S4cwtIⶎVW ˅bnЖ.Z4z+:6oCߌKZqhudmQbɱvŵ_KX@!< k˖Ƚ-uSKhPPC5>Pwيk\h&ӥ  ᘄ$Y*<_^J4Z|":Z_B*:wGhَ/$14-C`;fa9`TpMy4rm/G`xCkb^SuSZ@Kùr1#: -+{Ҥh&Cs"ZFV) 74c\b㺊6Ow*,N*dg-. :FN 6}vTv eh}[B@awhS)K8'еIi@lBoZBC)bh‚N-QFxQFk-1߹.R蛑!y 4b/i|Vi9-㙂nzni2ᢡLH,u8S[eRt?pnf8-l 6<{,,ql>4ܴYy0N)S[ Yˊ4Ƭ~B[0rs:V$jl9kHN,h?hL'Ӊvt0hL'Ӊvt0hL'Ӊvt0hL'Ӊvt0hL'Ӊvt0hL'Ӊvt0hL'Ӊv4C;O'{9 endstream endobj 21 0 obj <> endobj 22 0 obj <> endobj 23 0 obj <> endobj 24 0 obj [ 25 0 R] endobj 25 0 obj <> endobj 26 0 obj <> endobj 27 0 obj <> endobj 28 0 obj <> endobj 29 0 obj <> endobj 30 0 obj <> stream JFIFxxC    $.' ",#(7),01444'9=82<.342 q }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz?M_^0ѭ4P~A=;5 kOmHcd$Iٸ(>. RhE>dTWX>ROyd::Q #?i_Gҿ'G4 O*iJȟU>#'Eҿ'^DuZ@u{ј-P23I=2}N+ht[qd͆kgo1}8x YƲFєSQEQEQEQEQEQEQEQE|J_-klUt9Z8G ƭAtHL?[ /_$!J +>k=AW/eztGR`(mC+.G Wh!,4DCFiBWA3 o Z>."F0]`Ocd|0;?x5k-WY7a$r? ,/,4RpIz]|7\I4J~mCs5q_k/|..Iu?A;~xv?GK#O{[0סxr^p\ꈤO4C 'p;cǾ,ץo yE @{I5 6$w:o9/dVྲྀg9o>ug5ZݤgGoc93Տ~ZZbѱЅ$W|^&\2SqSbGЏJ]McVOPy(u|;=V HpO^,ּ/=پvm6zxx\ŬxWDiЉ-S#SJuŞRIu {9n~:|g/< 5jBgO֥lakP"s~i7q/tMrlE.!@ ۜg u&Oyj. X`\j~& :sT2lU>8x_ YDDhLSһoƾՠڲGN؊~ xW0ڲ3i^m6̓k2 ~ qI|w5,o<:0 5<7##O3Md0~Ƴ%x|wG8A=b p{W |TuL$ZiH8|Ϩ{5ݵ7v=9cmzk>&x[,|c)zl0FqH A-u+мUfFVe+7rR?uW-/kSsH q4<|3cp^x|#u/!ۜzԟi_)U{:>v}/2Aǧ#kF=F̷ҮI7Rdr>Q5{G8kgHV}^դoH7s^^OEmh[<n  Oȑ>Iu}MVwƞ|O VUo?_ k͉;m?)9tJ~2u yW_ :[FX" .+,LrB.=B |B,,$,؎~F;;Ͱ컿=ns^X%5 A(= ^*BhE/z/~nbϿy'C?e__oTI\7%V?o w cLEm5 +!= &5R+ګ ?{ET"cq AAib䴚̱qی;״ m=Q:Tnk>z5\&CdOqk..`h1䑂ROJ/6b0$m>vV q[g|hx|e[?xbGqR߁2+; gU }~fH+_U׊~ϲƖ~'c^&T$>RΥ)*,V-{{m0Z??fJ. E#/kIYWάQ^%P|?ڮ]ى|J*A?yŷ/ p?魼mִaX3K`?+N"c^(]k WQԴyd5Wq8Lנk^]ZV oZn/_ OOV}ƱjQj>ۊJ_7tmR}/$ {qϵ} PU}ma2m$xv푟ƭoZOis=Ē]rOܮv:-ߌ-TJYc`0xb>w_YCk+,^&BF3F/~ wkA[[cTֽMඁGc vg<]jޛ}Cb-.66N#zG 麔:Ԛs jWhR:סW?t{ox(~T来p"m㻴`LS#FdYޝM='J6fUw,r'O ;4Ni67.pA ؃M燴 h\n(X!.BcWA\.^#5}F.22\2h_N=FMi.!{Mt q\x`֬Vf\vчocǵq#,ʷZwl+m=1Ak#O.+[Hc}5-:scr AsE  ׆t hi18Wr'&%KԢ&HTʞ}~5Ox{XUn_Rё$* C,ʺzi>I^v,ػqɫ?ZcovVF^;{_9K-JGݜߠ5:|g^GJ͔W u/O,Dmc^s÷!LiZKuyot$q!f }A+xО%h-,gσswZG?toh[Tצ- wx$ mIw2 ¯iHK1mJyd2ѐ%@#) Iw-ƙCoa!^->k֍mces%I.ǂqYW-ֵO]vSK}7 qU囏\ dN%BEŃH= x$ֵ /iNj:r(!'gDn)_6ֺ- x.U$}3># seYRN+D$ {sU~9.gˊ'@,q^;OD1r˳pݞJ7f_4n8*v^3]]SZZBh'W ׾*O~9>7O mV3 })O.5 +m6yso8qg23bMjQI7~eF3Zz,0{k4v{g,p]yF'[aӢ7WBjhv+em-7gc: +R5ikk*Eu5Ts̶Lm'g^UwCx6 w$rPҶXifPqڷͬ^}ƽ?jWWǝ)l}AWEίx~?G1dg^0@+ GjB@hx^?tj"KfuÌW1nzk(?xWכ^ {k\GvěʏV 7qKqwW@oyy!t({לI]<ya;I}[  S#=:WwZޝ,ͫxM]@(|93_6Px"TOs_/H"kwA 1!O5^?jf݃6Ѷt u})EF |}3xPt-c"FXѐ1zgmkۭ:{QֻM+n*ڮyr{5:/xq[NDW-~ǎ#>o<{W? 4ލj0.ቄ1.b)߁5]au+#V#kʣu`U*]siumV!Ԫ"@zϹڟu'U5 ̖L'B>jχcjoswj [7ɰtUW iMsYT$ڸn#r l ws&@=n=Vy]R3p?:i\ ĚƏes!K;gC7))c[Ҭ|!7mRHgHdmCcՎI^-l})e. uxILJu O{޼G ɽBg5Ú f=~\m)y-ZuKgեIg p9𿆬%ǤXI3Yw5\;[nMoLԯmRd !lPk㵸EB࡭<)c{4 ^kZPCz< ؎x~ZtT2Jt򍳼LJtMVM;Xtm0Z񽤶"MI t M1ݿ@A^6 (׭tKUI-;{R|C,4,sb{֙Eu_ /쟈mnDLsCWؔQERnt*{=:]B5Z!Wj/ǨG5W#k+ɪf|3Ԁ8{9?j:*H&{{pGbE}^./ݹ&FPZ+3S!mKVӪȜ yVm.u)Gρf^5˽m:Oe5OZ8gկ$?%Wi? ti+O3G,fH2?Pܞ՟]f@n#,!ac =WAEQEQEQEQEQEQEQEߴVDҕw_ߕxQ_[#Կi [/5{lb;z+jGOQnM岬+#kG~+ղ/|EJ TA};cԓVl4V-4I c ~z΢cǓo3{_̟jO#_aՈqY:G+|E]W:M+p1Tv?¯&p?WcEQEQEQEQEQEQEQE:Smn-JW1@!X0I'?4.Κg ƏgM3 G3C_B/#>6 qI1)R@q|;ivCϫ)ͺW­qaC#J1ס?φtjwZc?oj>3{FKTNK5^0Lt=8iySGS_jKMm>[F?7~((((((((7>kaO16pzzv c' ?᣿Xh?{;+omtI4_eVUKcG\Q^3o~o[= 3qk&=ĩB: KVXX[)1qIF+]Ol7Zܒ8ؤ`~'袊(((((((kȌXdk䏉 ~((62?>\UVׄ5/iu1g8?5W_e.|!?)*E_μ)UY*Nk;IR nr9A)Ϲ5EQEQEQEQEQEQEQEV<'c/Mލ43Aч|/j֧ҵ8|<]{2Ut95/qgkh(t3GEQ'x8'(^kpGcnVG^EQEQEQEQEQEQEQEQEo4]& MҮZ3}T-KW};U19AJS.E}M;Rkx e짒WQ\73Oឬr+?*o׼OX/OE((((((((+Ğ|W[ <6ƾi}gPskF?QW׺ΚLy";L5yjKi.`x[Gꚾqy{k,|2b.Vr&3{ֽR((((((((() XyghEe\G>;Dž] /BitsPerComponent 1/Interpolate false/SMask 32 0 R/Length 2>> stream endstream endobj 32 0 obj <> stream xM6`)JmvY5F.Gr+;RƼ?!cgqCg@-x_ $=46ؚ=+(۳lϊ=+(UEoAo.JH*ZSƊ/VQh _Qz_xJxN~\=djFap|R7H=XD!p+^:;ŧ):Y,Zdybx20!J> 490EV Ξqnh2罎4?Q -p&S>@N'ch~l (,~ˈ{cG .“f8QQ9>֙h4+"k:LH W{_pe;*Ps>nXB+~؆MQHUDȲϊ?rYTP؉y (YgpN@A!HI6 ?ydE;ZA=螈QZQ'zV P A h 좎7YU$ c1%l VHd~B09ZtɱVNN+E1_Rl&+4ZA' _P4Բg)+f&ʪ !n҇­^iQLUApN1}ˆ"T-]3"֊R̋"pݘÊv:4d?EZ)|6pFaK 8""V(6Ƣt 1G(@E4=RPN% L>L=\K4Mҩ*E2q+"E8YT R_R0&IV"8]KI"VwIS)x^&});NH{lKO5悂٨RߛI2g^Aay,+B{;iѭy2l\K&Є2N,v<E)$kh§zIu$ ;E*F)\ppJ=D$QSf/WEƢg|zsH1S9(y- %Z1j"q׊"]09OWaN}X1EVSȑCS+fU$~7"}=m[єR#!ZkUȊ4VNsQ` z~Y) +|b(+xEK Y+,b\ }¤gn;Dy[VQ[$+5DIxԚ]"|cEEڍԲr (7} ׵ؒ6bК^ت/M.cCOf0y^YVQX!!݆piZxQr?E"uмsPQYmm;v򾶬CVx]\rp.E?c7бREXT+mjW@Co tۮXNAсTE<$jd?Bo_&TqvF^P\i{VU,Y%#/w}oN{Bw?nVb<[f] /BitsPerComponent 1/Interpolate false/SMask 34 0 R/Length 2>> stream endstream endobj 34 0 obj <> stream xK6 (Qt4;7Q4"xi ?]=bT-}zQ"iOqoҸlwQًJ-&IKSJ|&OTvHpdy[ix2]yn8W84bqyUz\pA'rundgaYY' v8'r,VsR&Mp慡ݩj#n _K39^6w̙HX-'C8`npͣPrYA-pl8'2بU\xz sc?ͬpMup 5.^<Wd#l*+vW UAqi2z\Qz BNw亡L6SořnΏS刳.HjAf rpᇫrpp!Q^|4#׋Ia5{C$]\w܌4U6v8[\ 8vz\iVBX8on[0d1՛]ޔƽqo, endstream endobj 35 0 obj <] /BitsPerComponent 1/Interpolate false/SMask 36 0 R/Length 2>> stream endstream endobj 36 0 obj <> stream xM ` ģx4<&ٙ^@w̢](cn]{[~]ȭ ~En ?6<*Xc`A^cV/~ثppDk{~u4q O)>Zi`^z BbAE;Q"Q?ˇ+O=1{ޯ&{#<s$y >MjRcx|>\Ã2%-$LȞ˦,a8>yN͉w?LJįZ ˶z#۾qp'}lR~~D}H%Qìj9^`>5yZ\M0AZR,^秗2QvVqq!sC7hzSꠗ~s>K>~?~[y>{ǜ'>}'+w)~j!|RV.LW~r5{ endstream endobj 37 0 obj <] /BitsPerComponent 1/Interpolate false/SMask 38 0 R/Length 2>> stream endstream endobj 38 0 obj <> stream xA `Ɏmv+xQ<šN7OyV*A>Dht[{vui̧3מrDC<".۹pRQvu e'<~|;3n岸q=~GAڸvp0sR]?M.NRap'}q )Ypd Qgtevfe&ø9nq1kheGz.:.뺦˵ѺvR!ƅh]nκpvƅ(,.Unl8ܜu:[7|u9$J`dGDj9MS[OZR$&vaͻM 7p2xkj M;HzJҍ/Ǵf,)o:KjB7N֞;B4w0c.WZa-%'aIƱCRϸ8j8 kYi3tZ06^Nk\=w!pX:_(0N3q^BFA5kwaMd&<(IꐈP[ƙ.Me+hLk\k><\'7z;ir7μ#W4¹:0`kSq%XW#+{B1dw:]ٷVt>rj_Q21juv]SaY6]U~9V;qQ endstream endobj 39 0 obj <] /BitsPerComponent 1/Interpolate false/SMask 40 0 R/Length 2>> stream endstream endobj 40 0 obj <> stream x=6b@g<u ɡU :(<Q%@Дzɪ^ HEh]-к@U;?iV=v.ګT3\e 3{'ٖR엒&Ik2KtwwK+Sn12wE?3ӖL)%GPHs0o8DG5ӨYhaqj%:#fg^hwl{2-@m#Ӌc|V^ ze9X`6 +IV1f6L}ԝ&'3MPa+ڍʹ8,CIjiub%;]qKgfs =IK~Ez|ꨑ lWL4*mohj SiXD6;lgZܭ/6>Ӓ"\M#Jstר"6dt8XV$L=/Өhm;hˈ("&E M';YyqOx/NcR,hx0eZҤŝFIhʃ ZSƚ|?D+ Fu!A󱢵kM!ZyX{hœpQL)%{=@=4L ?J`Jt6L}Ch+"R:$ІHǭA⧇4Zti۳|C1z@znP֓ O]ģ6m ֟tHZ*CDC$Fƫ%iL`TӶ-fJ%R*J@@N5`}֦m`HN:EVZP?)0ژ),h}i4gi}Bw4?UP-6~F/uN4)ߠEHQ{M+F a]WJҴ*lx4 oZӦLkJZr^DCNRi2#6\ X:M?44'@ߐbD=--t%+>/NTiQ,؍wߨB6*p*Oi8ؙL`]Y V0#6~^KZ@6:ikIIa=;YJi-G2JhT3C6Դ4סEwH݀X3ōn4gV$b'bsװ)nɚ )%ScdGR=򀩶x<;;\aVkOEh]WO %e endstream endobj 41 0 obj <> endobj 48 0 obj <> stream xZ[o~/E$ m g㨕%CߟorHbZq3̐3Ck83'Lbkz!^YeF33OY8,a^aP,HϬ`!Xj&h0rLH/L( G#>XŚai>k v 3C ] k&C)gc02DZ0 (-Y @| cx DD03%J`ESXppNx `eJCy QЙ&T9!9K +#@ XkAC x38 ǴDK'bZo &%g(0&%kKq >nȇ$: 04ng *"%iFqȃ༚P䟰 - ̍W %@b|! TC_/;PK&JBqc%94*I?a&>/_!S, @!jMq‚CYx4$ 9w&C&G xd?&#qAD $3;rp-L`k!\T{nAG/OK0GAG hdzzxP <AA0Wx|5MbzM8./6埌V9W$$WwD'/QHyqm;m>}!hw"L<$"g1ɹ(h|s3W8 H$Yfݖ}^m؋z~|Z c61 r &)nNW/qx=И4K21dHӐOjJpJ7~ M>EHg Ց@/iQIy11iUkrxN#$YQn)GŐ)G*ijˇn {xJO߄LȌ&ݕxin124ש[ʹBT1ZzLvOsAG[.DǵʺR`F 5`%bT?TS@hW^"&U7^?frK֫ UL*Y²ͪ| ȓUӭ]i\+u3F}ʞ<^](F, 7#[ojW݊.&Kb]H.7wiO.:i8H/sJkze䘳5Z 0c-6zI hVovDï,$qw??? CzE/L4f/>v$!8߂poY=]ѭc"w}6ы}?}w.odß=-[˕45u!]6KEuK< i3CGcn〧}>0.h7Jlm0ј)h4܌cy4Kј B?sOGOǜHYCYNҞvrƓ1#d?+> stream x| |Ty;e&gHM^fHl$,IX2dFgX4"q4u)jV-ZZ;Wmj[KֶT.߹LBo̜srK h[;}Ov>~[]Q5._\48򧚷߉U5|A憏=y'so ܤO-(ڴ5ܟզͫ-|ڂ3[6ZD}ղ^t'ƬekW(ho^ֹ|52@8mͭg0]|VNJu]m\~qВ:W4oz`aR͊VN>+5p.ϻyEv۞_ FZv݀v`&3UkV]V&kU}?Z]2pkcnyGM|: :fOLv*O}rnadX{  `'ncr74۔Xe2A|yW@6S"K_>(x O(-lXTo?@ѮO3BBg-ks_0t>_-_RAbԜLq4}Ix'B6/Frֲm})ҡ˶5fWM_嗋F@ #Y󿭗2^!ϻ3d9L?VvƺzW}=Fe7ÈJ /½  |B{ò!pWe~u`FhF;kY1< w1> VLx݇AR `p{bl0s(od1I#oWZ &s}H]PF6'W ؿkҿM1sݡ}N ~OGl9O5lo Ɓ?%@aM4w1B#4BH4 oB>Lpڡ:{5w n{0B#4B#4B#4Be$$x9W9L F DP@ PQVB,6rQ+7;/ ȭ\( CЊš3n/wȶ'ؗq;,u@P#LzPߊwoM`kɔ ~="\ ep5 #BP)Ԡ&-)OM28Is3LK8 }±D睥@Rj(5s#'5_4Tcqhrϫ?G\Ȋ֮Yj+:/8yDzK/Z`~47nsfͬ1bZ|ɓJK&N_gI^bN1uZZT<RM 4iƌZծ*15ձ MUX_^W)UrGǤSliU=|vuY#k6&[c *eP)SUr]rgZ=}M6 RkHLhFn{gHU!rXPf55Ŕ~$vydIsB?dCr=|/W`)fb] ʋPA0XɁ{t 7I>6UMWkޗ~bMK[:6uKUUyX X{ P !+VlR)@ds|nD6Il1hjIX X* Kj⁣=DbQ֏'%Pimy<b㋅辨iY̱؜OnQ±=FklP Cf.9fb<0$4X*H`3!؎7T4%7%ꉩHjon|xvCg}T$ xbkPeUA]ݹMay%\m(}Mo){t zҝ-v E&A Bpay us⣪fSY3 j fL'!&{j*㞙Bq,rq9S&L"(#KPJuL&'GuXB|<,̃d7r FfOYe@$d ".*s8Hh'X,BB3RL$4:m]*%T  $ wEkG >$T'8F>%+PٟHI#Q$x#<;Cx5J 0H嗔^&x?'8D" ?#͟o>g}1c=駍+O{4vxǍc!?߰kXgXa䇑b>؃:1"?#Am{w7yx~>VwP~/=w#߅|'򷑿|I1yM<{ iĚȳǀQp(a#mWpNχ5!}^aMcuAQn=}׮<\"5%k }Ykb;oJt=k ?;Z RS]xb4^yߤ\a 0@_w{a0gU$cɎ4`UN5DGɁOrNLās`\8Psf"X :`9p!r;U֠z؀u /Mp1lMf؂MXNmKeCxJr9lG;`'\ W!g,9 W58C(e87czp|K7]p/ߚNDFt]8<1<~ނx n:%~;z|\eC߈6X6$ȟ~,ۈ;q6.f-`]L{bcb#:%4$95d+d.KKO=g-܏|><L=+`|S<L^{ޡØ;U%:g? QpP=ҧ%gy܅^~]f"$qAx~J3L`bskZu=P$yXy/`,^LBuWy$ F9"ī*O8aBqqT~|^4!ƏO*e*iRTfR *~9Yc:5S)١Z&*jqYZ#Z։GIP4Zmu5JӧǕU*:u0vܲ ]: P8j|hM &ՑR[S)3O^q9:`i].FS'K8vpyQ~+ "Av GB&ݡO4A{[(՗n ~nhPV'tF_ŋ}\sE;M=c ]'3F,٦Sz<&ȦfRH>WS$3jIBpSj-#̴NNot}*u6il4%Ecwٌ'1J CV z ͊\͘o&tf<0KB^^YV9<ݖ[+3y8@sXI)/OuZ˹A]NZ,uX0-\`kd.a^B'*qlF ҐqsZ+^g]bN3&;'{$(>EcjfcJ"%ß7jMˢTubٿn1S v v2ZcZQagǤٿ]ŹQpnTggGNƠ̆^~^X]Qlei/DžL9 ֩QK%b_(A [`u8- %s3 SnR R_`|ŵ#>5W 0a"G{S-q>*AH f%7?ԥ42$gRҲR[]uL\P5}j1NQvYI-_o->v:r`%@U8V;.9q]zIܯ_Xk:K[l3u뎶I*VKk'-_w171&+ؿ*ǃ5v&7 .k?m6QaNC?x|Լ;m:6GagNhS섟~ړR3irxM۪66jN`5*գݼYUja=*e5S\f3: q(?CF{Edliִܗ2;]* i&+7k:?imW3I\3M -7EWhC-ieZrkKie 5n^0%)[XQinY[S3ՕEMN˚ܴy`ɂieK.ڶqpEn9R/N`PB/yAYz8\֑mPK9~naI^}EgWP^Xvޙ\]ng08Xa9f9 n._Esys68i^Suv)ZFc_aLܚS^xKeӗNI- ONZ!hTױ8r)KO/ 7助a6pL0cҍqix/pM,+3^ռp=S?fyE엖r0h 銗MjSxS]i8Yٞ*ۙeUL+xPfV˰c?bS%ď X ̫TZJ5azaq҄3k&fmEEV5x4ϟ2I޲p빥ۯ?OQ>֪^#a;<O$_1s.]4X-)*e3畏+ZT]12`s؉Յ#7n[!=h46ejl8}VjJ>JKO C豸˔C3:'F!{|ngM۠ZAſw 7j8qЎb2y\v28Vp.-Nj n(wڄfx mnyQ&o7;tT6ɧmKkjoˑc”^sn^X5;#ɂfy\No{\,gVڦ:^NM~/Tg35zNv}if,l;K4߾ޫ}w*dIbYɲ-V^lcCX$,@l0 6giIǁ! w$= d1e0'gΜAսw}BD 4E#5ѲzY DoaRpF_a}WS?QoC;>Vb,N¡,DBU\y ag½ݱ˶̥_VT_)Sb" tTX"\C[r֣\*(mK h΋£2Td.24 [f, 1M״0lLwtL"@[rW{fjwg=z$eYhн{t8##b Gt$R!Vy.ǟ9R(!PƎJ:}9DК;/>(/(.tYhϫI"qۍsjpra~Rt~pՅ%VXPÀ\H_5Ud}Y їÝ& 겣v8z d锢  wUXQu/jnzn.L4z%6B=&oړbY`4дbsjф568@O澬8+o;v/yw&Y#p@>h f-˶lP- L"26Vʧn `̦<Ϲ].;J|Z47@ M3V$[lDVg fXW*Tߑ#r$$; _ oAw U|p?ug9A+ZW`;ihCɜĿ; Aj_"  s,<>-ȳ`Pf-P󙞠]Kt!,cU(X d je^" MXE||m2Q؏bIUY{hvx80'PVvvt'Y_?+KMMM;\5{Vwp,%p]p@0?zd!gγEod {-SFIk?VĦQ{F~玺[Y#1{jj4?׸.(6+lܶ>[9r|}&GI d]M{R9Wg]a ?<E@,j=C8ÔmVMc֞gI7WP+Q e:|M`&}5 #]誥bB(ڍ3.3Ef.,a}3{5D@JQ)cNa$։sľ p5`]DlvRJ2_m9:`h*<oiݚb צo(I[ޝ = d#p2$EM3@KV2]h$V.@6lZyfq4gw? 4F0Z_ɋv&P<f',q!EU}[ rRӧ,H&ڼ\g nC}E avl|/ T'/Q("$Azo;aflA/a0-Ayn7.+{lK CR0h:|`A*Ĥ}O6B^{I;Cj՚3>?ByH!towXܽ7eics`$ӳ{q-' IBymZw]SqSu/ q7tk:U1Vp5؛m1-|C. 7$_;_=:G)^L4N)r NAVyH䜮tM|Ib,Dގp51I'NJecv)).zJ HU$|0:Ta@2˄PT )Ep\XS[a1kĿ2 t$ZIK kdQl{C5f$#CP,MbIS]fCo4tt1I슍EjD$d t$&ف9Bn'iRK-fb" m*S-ǹwLE\>`Vo :#ZH33`mbD-MōgIC]Akq7022 0b`~h&Ҷ: L߀?V ȃj CL%{= <%#(T?|>BI΅Knq!zJJqՏ NBp?c->zbk.Ih9|cїV?\kDU"wCFkfjx-3`#,Y3:2>͹u6?+*cpvNk]`ow.](pWBPv%\oWb+iџX]: FO*>gtri]bn"iAAP,Y)8e_ \>7|gxI yM|.q^~r#B>J'j)P9.HRFDWlm`rp$V@YQO4. U4E~+ARD]#5,J7%u"@."EԚ*}h 'hIeo[2dh74,QiM=7ӌd ]T8Y8 ~f’F*3(:*}=t*hb+_ ur瓩9/*bQS~p+[ 6Gd D@b<٨$>UVk͐&_!d$\/{( aGa6yOZ3pDlIV2ju*# cC_3n Clo!^bp UTVLu-z%1t}RɇE !+JF9šf5c.S#ve$}{ ֕usFv__QVtD6{91H`iZG3`3;6oݞƀ/f2y {9l46+4|gCR[GE_( >OFUeh)9{@HRGͼNlA Y6[avƎ#,3#ov)B]JIiWs~=3\Wڊ[;P(.VMcɦ#o%`du6e>udh$$IK9Ny=-@^|ĸ"uaNqxkBxN'NX,r))SތrUI3l6LgH^jcnG)FˀKYOXq3Z-+5 +z7 kș~[@G=t &c8':oQ>9iOdɉRIP&<%5zka7~ӐG=Ejdh}XfOq1`G.#{t] fOqXg2%+N4/ePM_dg (MIp6+vd1',aǓ =VQxU< 0yP<-CeomxyOK#lZYY1.Od?<|s<%-gh$qQ3kUmY=Gwzs+\91IJԋtu9R~CLhtJIiNCi>*]s<:NMadk IDZ=ki\ X(ըWwǸϔ ,x$PFIrښc,@+{p`_k]b,Vy";(\&Lﰲ']]/mqGm|T_߾- tc[U4_|)l-^ֽ{ǝ!cnӝ#UMʈ{pl|Q[v]qc0JdMm=`!p:Wxy%D2惰=)W|1 *BCQ B0T\qz@jy$`P1EE={-22/Kl_bqR3^!Fb(2=`ƟzoF>"e#;3p)3ČOEق3kkr%eX,3_ҝ/32‡eB0.k5"O.wtmmhU[4 ( #tc43i@䂑 cot|J:AtX>Al?r%0*CvĔ?CZ0vlY+'N0ٺ=d1f5,^О>c#4V}=.-qmHg &CUb3O>ߑ'eH_ =h۩ȍ΂! T;TE/5 ak`x-;}@"X٢"#]ǃBcoL,鉭{p? v`,~{7 m d2{ˠ WWv]i 4҉ܣ `}tY@@xs>_8L䉶wrG'24 r%/eO׃F[jc]>c-і5>ђNUʒhw=>xtAL:lRW.=R1HC}S}bǖW JČ%$ o}5hYՒت5 9ٿXտGDS)hԓ"3wl9!ql5~<Ւt(e1:oC _o˶$T4W 8@TRoSW׼ 2ix>vӧ Ғ'Qr%]A V D5 ;ODJ3D"5uA~9a㚎X.˪]ǎjJiQC&5|;~OH'l@3ap&  Ԛ %Lt~LPE qq.X#`lzVL˛,9x1J z߮U@c}W-%'}ӱy5ƍcVyߖSkZwZR0qRz{MFPgs'MC[R?7 Oj+vحcmCUG |DC_#͋DCC@x35GC@4tJaB>eॹQ39/_lK~o;Vd;[~%+eI$$9iH4?t ]J)}ۖtY M5-7Rh-Knm]R(B.773ؒㄔvd4g7|3=6[MCj~. f^߾'=*xo+};{T *MiYji uHؤKɗd3T%m젩,H+Pkx`M˛3xmvwƲM'jkoߺNM[4}PeYfmaYE:S4"fXTYaV$ar׾[?pΗh]kB+CָpM_^?桼"V_^ɕPw|"b&T7O[z ?{;彐NЦL){Wo{f>i}l x5 zGil+  BzzM)GP)@M+Ekyi61r)։ĥ_qYy(nԐ;Υٵy])1VŸukq2'4T;!!R隷Vox6b`]辻vUA@]{hvN1S3:ѲY>m?WyXmKO[0w߾wTW羻#ŸZ>s}wErUw] 6b:-;P7z(T2 dAg.׳/ܵVP1W쓘=na_6o}OgΤa Z)C/8i~eЎ+2-2`waMs߹_%(L:maMԮ;~Cvֲe`|70\fiƉJP96NU7Y{>kg}b3D!C6WJgdTZ2o& kŚ֌Mt鬙LirIq-wي4Y9XVΔtLiXCe0+%E QX?1r{?[;}Nqem%oK[ Ki"R_WRJ^Z?ۘ0MVT!xʌ=U6MٺWquI]WQ7hir/?ls jrӜK. ztZ\owF50Jp-5Yn\t$~m^rGu£Z^HVjmLhR%(ۇ,j:EdEE..1\cʃo]yn},dS>JZ$}>j,ke~o|kug9kn\nѸ+U;3]_mpNFooHoڅc$cú!FIRPEHN'sf/||OһLh5tKIJ֨bl99FNe5f2YZJ64ՙtDZ +yR[hD~z%PТfmueM]’ mpC df"O{*gFKI{*r cq cÂJ^ L1+W4(G?Q Z,iҳh3+ j6fil,=x6m701A9ǜ$9+Sg-PrSL)dI^Z4 +KORW_gXW;mڵ9Ok4Xolh3)j*V嚔WmE͞-[[z3\e-7\z9~3dH>#sXpZ]-PUz#_&0:=/ÜE54Ƭ48<g@Q0jL,ae2q4Ug_5 Q!RǮ"8fPSu J=.]%_{Y_Քbc-m]MM~h9O.ތw0=XWW8`>]X`Q[r>tֳĴ/qw;iG ͒_D++Koe.?Lb(.C3uK4B^{VQFoi䰽r>"SgU$nԸvSʠTq;i[|qYqΒ~Az瞭[4u:eFiofϏ|`Mk ,mV2\{F*m,m//I.ͷh-%75my"2е2Y{e5dCd/W2EOddp様"a}6I _,gB1? L!ڶn$IB/Tb + dhtfpm>o-T[^N7js͐~3EqXF:*!h2 **=;S4r=iic\,S0W]׽Tbm-^*:w^W$VA?E_J+\t _eoyeV/2,YO0<%{AR{y_mIOyE".V]kYX6Xm\T "Z8%w#Eܘ>U#HT]@0 վtYo`mx$vOH({ seecw+ Q-'[pN[*lUVW׶Է2E 7mܐ!4 .4o֬5xA{ɵ.͜~f+jMO{:8NGF|q $֠#W蟮F;$:t-RmG+nZIWjSIߤSz߃N&k(OW(}Dod>s%e|:әkkd^gogJ9rnG^Ͽ#uL$uZ? RKUOLTX[@QD.&xIUsJa*+{-хB/VvTJtq.B?T}J6r8ޢT^OszK͖(=JuuzDDdF6p_cNNNߏ6uZuZuZuZuZuZuZuZu !+գ 0H~v5(sHi[)K'K@y׹K[^;^raP_ cη|h(H<6h(~ y(@P.,1wB(/FsY@f(#-sZƙߠ\XCX (sHi/|h f@y! Hy\#y~9(#9p;AKm^@;PȽtKKw[x-nrwE<. 2x~]9?ByqGP^Z!wA;C;C;H!/`lP6^ؠlcؠlP6^A-ؠlP6^A-ؠlP6(ؠTv J-áG~d G"TP-TQN L+]D,BA(XZKTס V ]P(2]T Rf>,Y:ޖ<2X. (О+ՕR)U(3R]LT0CciQ%!u(YWrR݀l_$ #?AδNLδNLδNLδNLδNLδNLzvAS; 9Q jZ? "qNP^h B-pD䁶 4 (>8jc@31 c͑@ȝA?jDv2$DWq0CIp4 4/3ACxƉDcpzRur""eugoLXMI֏܀ ['H]I)[OJQB$=N|,V"=`NMh\ EH1DAz˚%CSrB :1D#A&ĉ+ЂqX0N$_Nqq{,*ˣLOTB)2*'ZAG]ܐmKHH"^/ Gak9(ԏaI\A,G d&{H"Ylo9R$c_b$ _ȍ.kC1NHڰ&H>%W[*ٻ-V3ΝJF,C_[INJt_kw)GwsC3'*Q(HcѬn':ǤrB4GG)GW_,[Ktv J/U  ٗIlJ[ەI6'uC+[{f_dۯ"*e\+?+fe%}hG>@RDN(:Z&OJ<]n_ڑF>O4W-)Y #$}&k$ub+Nr՘k*-k'Q&,FnrvmݰZzHDȢ8 ZʁcX:_Nr[w ۉatxd+%>Vj'6!hV CgG 1=zݒͰ}hE+N *AeyHIxn79EkNbArDIFYKcI$vvrl#KILBBþM"Gx9BwJ.&W*t|ރqA~Iu4A_,'H,yH!B'81@<;;=X`F#sр睋L'Pd"}\ dgX_N=ް/ Z{#agLb(Yx$&vBA7$J#O/ b3X@111#b_b<Sc?CUX0#c o0wtzCX"  %ǽSМ8LLD( "0n0<5a? ѝt,c"1|q]}(qP"@ 8xPdFחa1m Ƞ "Xp% -%57<'76_.`[4x8-BJ^0EX X-Q$HϤ SmXGq/fqGߴocHb2nqL^F&b\/1 'kh獓̷2X|: !9'2 !8hq36\E0@Ƃp,x;`"VrX ~"12G_;ăڗ<}<if2LB6þ4́0DLEN$vp-t6ÃXGSģ,X")%g?2ETy @pL' & 1LٱCdLǂ #y`x00,2 9e0 /` 0 O7% Q)\R3*w;s(gfO;vL!0 c'NDUt=p*9Pys~>b.r@ Lj 5w YDzFakБ?uQ.@:d%/!r8oc(I>yXC{Ɍ Hɳ!A1 9G/ҫ_;PxBgi;b!=N>o"v+aG8PpI@oɃecpXDaO$ JT`t\$'! O/;1t/z="0ޱmZd߁nFSBx} qEe Rӂ^Oh !atz}=\#^ipʊrtGnqh `>>NSQdܻ="<*@ٰIG"ʁK]?ܐ{]Uѵg;sO!@=!ZH/!B B ETDŎX^El4Q%}="C}o}[oZs=m晙97wxs֥],O DmP[8v8EN0nPvAx ޢ, 54)8)umR gC¬:L 0 ]txf" *PjC)`ӲpØ ?/Pka2a*a{n gd'B8p6<22~@p:M[ 1IKxG3DMJ8G :|m~2pZ[w!;kZDxI "z߱P)w ПBmY3 1,şè?$VkT~ | E1{bǼ_ڟgFYa՚aVxXO`7˖:pY,ų$֖al`x,I-O|O D N-GmR4D2Ǜ'{jsy(3t1JQ~Ud$yp|v56p5v'Aklo_^;S_{X^䳷\^Nggog_kqn/7,'G۫$1.FEjXx-m10*AV1i?_5|&KNȧzBJZ&^z^vҼ|y|vZ>;==)6ɩdS'SgC{ fi8o gi3p<g pF 8<^P, γ* 8hFAK7*pp3 xn$o 877XpRS<5o+4^Wk[M⮱MT^;kwj]9b }dHpV0<`>,`mpNFJ5(upj]g<;^pЛ란OEnpЊz{wWȎLtebAAAA5Cp`j#PGBMpG{d̀Rm=(oӚm_ITZA !8{Zp 8iӂ:m~$MyGT&>V>j$,7Zkwdg0T>56?392ݿ#!=C681ǹ0-1]*JX'։8{{!vN1A ;~,)\(_BB"6+pzr-xB5;:֨Cs!{0ƚ([$pag#S &K5/05pJ!:^D_1BWn"vJ 5{{V Y-;-ikxQTh*o[ЖK[8H/Lln8 yy ,] =?~ ku`2f%a i,l36}&<氧QvY;"a5? k[X=I%QGԁˢH+høxV<˄1xse2Gs c5Dz]],ќlNf̻ͻY}sWhk`=e~6حey9r_w?ZwJփꡢz!(=Jc걢U*m'=QO$=I)z(z*Jz(gg2a(_/8~]o7EyP/;QQ7^z^.G#QE?UFT_/DuQo5&I$עF#jmzwީwz-G>Q_D}HI>"\+q}\4'IOS>ψ&>+ϢE"Hտ_E }E_-23B}L>hOӐ?B W>C+}A_me}zF;Oxړ_tD@'Ol7tvv󊠗ŠŢ˜+1#+[Z^-BW2^5,(?T?1>` ` OOwX}- OO71fÜuDK# ~=ېN_*ʁ Y΄Y0^;KXa\8=s+@? / D4xYcOUKŸ/ &^^C<9RoK뉗7/ D$feᯉA^m%^xixvOֵK .|G503PfW@e (?P`ȡ@Á"GE 9(r"Pd"E(r6P@XH\RT@"\(k堯\(Wbe,Qe,#eFdDKEE,+eG܈"(byEE"HK~OB" E#X#XE"XE#X"XE"%EJ)(R6W@r2e*T )PrH|H@""XQ"V )R)VH@@"Ej I (R?PAH@@F")"E4 i(2-eZʴi(SC$"M1{iPmω01\.1C/fă!qPqTc8!N)qZ?'w"c&<>h'Db"BHPba1^Lvq;b$W<-BbYe2JeFQ(oT0*75Dn#J`m %e"=ZW"mĽ+uFc3bF wp=#(dFȐ2†֊'md, 7)M$B/7[bLkZX'ņ)W+xWūX7BkD|']=+uX*bHOħkc:|1Ͼ@,)ij%³v1٫Cuzzfnwq~ȏ|1 SaL`܏xx1 $́p? 0/ ̇Wa x -x?]xއCKa,s| 3X k`-|~ X`#| +*_· v. ؋g?p8p~Spяp~s3_\K+\+؍̻{<ޛ/3y>ẋ|γ><Ʒ;|??s1~\X?)l?O3G~y /KW~_0B!!aYt]E7[D!ƈb.3m/X,>KI|%6*vC|'v]b^{Fb|cl55ۍwNcc5Aq8b5rcqq8e6?gsyqѸdj\6"Yve'Yv]e7]=e%-#3d_Ofr(,9XC09\fr$F+_rM.rKNyG+iOΐ˙|H>,Y19[>.O9)9W>-y9|A(_/W|\ _7r|K'ߗT. \)?O*\-ȵsN~! rRn_kE~#o6]ɝr-{^OAyHGQ+<)iyF(ʟ9kdۿ싎('X8NSȉv ;ENS̉u;%RMNeSͩt:NIv9)Nci:-N+isڻx[խVwk nM[ۭuzn}6tFnm6uTmv۸mvn{fvv]nnwMs{-nounw;f!Pw;v{=q1{=~ldm'8zPZ9A"]E Q4%FѰ#%f~1ǴR:Dq0ŭ#KHb@+Ԧf fj{б)vD6IZo`:f)vC AU\+Co_n._7ؼv|~ Ѹ3Qr+c#g'=)#o0*_?F×1.ˢN D}G$[d2"y a13(x]W&SG䍛Nrҝ[N's2g3r;C0gpF:׍_\?ꎺ|CQ{bpupIåN9oX}(&F:CRtD玌8e ubݠs2 P eCF@]6Ml"{R\,dwٗПqp)|2f{}?G,x?şi?O8" '0""^UE X&jTXI Eohxrfaݏ g!6⡢DГdг,.\EvSЫJbV#^hkZRCC;XО:c ɥbwJ 3{dSْ} [˶lFU}nS5j֪j2ܿ֩j:BP3zzmPGF5Kb_j.ۤUϲyY^c_[l[m-n-^c;7lY1{qWd?aMa \/+ysЭ'_{'apNaY'] $1T8Wbn o-h—*yǑ %Y)V J32鉩28jӡ,ۍZel(OOT`8pd ijG٣P}d]V[@MڴT_"emi)֞]][FJ&捉<Tyc[. =yO01!{6Z@Y`[ǭP:Qv $KqcW+C ",ƐuPޏPa{s޼D^+C=U>ΰA5 zMh6$ӓb yuYԥ ֥T4 p_FwA52F!ARpc L^.+mAu޺ũeqv5Tku^~MSMkRM1 dg1պպFdh9tÂ{q|F~S_Gօ=\$Ά&W?kh̓Q _$]B$]XMFh`۰wX{u )o]M9V938F,b PXJ=`VPzJucSa#f:3pspsp#}?'y ?]폝`#3=EI[uE" }oqh״H;g![Cn׌?v{MUQ͢*BUx%^8*q28iR>cSx׊3UFahUELǘg53Xb_Vj#gM`"dX=,5GZ fcV;U1 a粛a6cc}!oϟ6U.pY<5ZUIxBT4p[aiP`"La6</Ûa4[[`'yaO_RKd؛Z'ӱYXQ}؛}B~-m_ęl@ 8KUX*kTU}sՉê|$Q=G-< r/R˽Dm2+Ԋ^[@- )^#ˑI xER&R) 9@:8&l&'Wl1[c5zve9Ui3O%f}Ts JW ZgVUkr?'q1W&fgyͽTɼ*]ݢz>*CUTꯚj`5D Up[!u:jbF mem˶mvm5ҭuVͺf Mv3j[ڭomv{eﶿ/ٿڗ+JpG8SƉs;JNSթ$8:NS߹tt:9.NW8cqέx6vgs3ѹ˙Lv8w;8:Sit>gs3y@w]u7{t/k5љV)UUYUwMrC "22( "bHB 11 2 *2bC[$~?S]owUwթT1#Mĥ8klM&O.\k-W>A7f#{G\{_=BK= b|lqc1}͇bl3/UL+1sιs>9<9s>sOpιs'9|*fO y0 П0WsW KS4XXYyʻoĹ+ސ7D_)dO25럶а5!xڎجa3c}:xg#9gcggSg3繬D۟Es}qFg۽h+i-:s"mt]_#aVKӞSS翻?P<˶ lu0ރRχXc"A{|f-/,gve؜:$a)?&RtU|i ԈLR uJs1'IA8ggi4r>II<<+;/8/&Lez꟤ h3rkuvTW q%yv{k>oXV`=UuTB,U =>V}[0d[N62k$ CGp r;kr ;W(U){qp^Kň\ޚm3%-!~cMȳ$G=u-;F7z du:pl+J" ^'-On8;ۊ+b5?ƶ-fj"4̚+HxYU֗8O숣!S83|^σիq6yyZw8ωKF.u BщnYNo7 G.S-YJkh)o8ommu>Z݇GIlv6'_p:E|9(CpFO׵xK2//b^+ļWj̼1DBA\Ez1AqŔ%d*FGՇ#Re|8#&NfybX oX%@lwQ 57Q<+d[`[)2ocZ 3h' 2ILw2 3ГZO3!3{ Qd״a9BdCf;A猇yV} Dȉ$I΃)Tȩ tCyag&Lg,'2yv|Ƀs@AMZ\!Cgڊ;Xv= xR!ymBK*T}?ӌmq@J/kmz[Q261&4TLg8Fd˺ec:a'>p{^eo5fN~ɞ<{=w7;ݻ[|Wnefv*Akw2 Ŭ@v`n`E`c`O:QTQârG7TIcopDpRpapupK4ZD'Fw=*zj5ч0n gPLfKbމSM*vplflncw ńڄz({9"ʖQ~ GFMdI#f D҉H "2"c $H&L=D1,"YD d,D8"㈌3{K^&M$@#r d!l"&Ld3"[ s"@7B"D d+D6"ۈl3Dn ; @$%/ d'DvWD"".D6""ED H 7D1Dk #@Od|K["H)R"|g  r@9H䠁"r!)#RF@'= H9r9L0RAH@"?"G1D9j D*TȏD~$T"Re Lj#r@T6D9n ' r@N9I䤁"r)9M4RCHD\"n$dle="H"@,"@l"6@\+6b3nCru.xKEHDg]ĭb9b >B! g>C}35=W˝YcCEK ,}Kb$ E(&2I}VZe7\qثt>쏈111cT Յ ׅG|iKncuЉ4N2Sui۫.2&8 @/MM.|:cY6RxU7?-{[#gC{u넎VO;VҁZZ39uc)vE'xH[ZE |3UG[skm\kcCVa[3@-"e+1" 2l#ct[C|mJ|Hxջ@m6^N5F4`?Fw݅+*55*d' 2VQ2#^o֖eoīzM(ӣ[' Dw+=$2M70_')qm jL2;x-GXeek9ՙ=gѳ'q2E[hV-wJ(QwK:<,ljuoHlF6X`?%JH";6ew>Z}b++|J[WDϰ"~9fZ}yʒ!e;VV0"c%=^R("6A@LUO%WFĖ6$lmS#yIsrD[Rwv%R]02ŗ%DgZl{Th؞TYWEv;I'MYU֛tNpP6mO V /kb^tV`o5XhQÇmGh?>O>[QAvm #hS,VǴGԳ ^5X@\Q# >>Q*rVS׮CVS,^*l~x7~n3j ܄Dċx5X8⟥7 *0X!ٞo8Ky;&K-'B<^AA05Yb#Emg'\m>r\`NGq]!Ҿc@83Ԉ QުG+eoݎjc1YZh;V l5Mm>@jcP ʿR.9K5W;0':1o5[)Eut=ޱމSBwƄ / 兞Zz-FлB> }vvB{B%ЁСPYjJɤH#]ԟ̳QL42I_6bF}s'i" ^$Br\@,Krxw~,BÕBvU_#I9MSmM ~POduknU:TׯԮ)b"bƪGʉ(L9Ig!Dgq!z~a*2E9sstOK=, X-6V{;zn2f kZg}`mm.*ʬ#VUc{Mv`w{ؽ~ {}=N3l{=՞i%2e{ho v>`ە <1FfFf~MFNA92,ʱ(̦r<9PNH9AɔS(RNN ʇ)gR΢̥|r6壔ys(R>F9r>B')\B,R(_\FE/QBUU)_|r 囔oS\G.z(ߧr#GPnLs|Bʭ(Sr'W(,,r/>RR~Gy !2))SVP@y(e%叔U()S'7 >It)x0#kK-H0EQ-|D];2fm(K(K)(PV3+C()=AJ e dʶ(;ߞ5Z^A9r8e6e.%e2eʾG[Q̠̦D92r+OI}ufYf/Ɲrs=qbDe# 5F,nV\b%dg:S̀o_ /QV'3ó}ٻ+!=0 p[ #0)X P52*;jFQE폪 z ^#Ӄ_n n Vo/ٛтw7DpcXO;#A?}$sZmnjn/1msW(+b{e}aG+UwN }D)}2߷v}iQZze܎Ƭkh35UGzֵº\_Gyuwj}ZOzK^Fi_몰>?p[b?h=Rlk=_eZzZZh:uK;jKbôz ~^׵PS벰Һ֭ujaZ]L>Zپkֺ>Th]GujGNֺZ[lOGúңu#[U,Zb׺Hk]:}Zvc쏛uOp+[gz~&y''rƁ1XEnSneRJ5QT|u>:jݞu[=SZZ[@q~k={:9>BZ9{܎z\sTku"Qk衵N4EN9n)y;s;ٙ-n'q*<>SYZGCoėkZZZ錟8n~N>Gf9zsnвkiIkjMY n%m`n{ mo{swl2lb6۱ &{ ;=xJնSxgz[=[MM_lm5m~vR{/~~]5JUY賖eŔb|f}u8 ]SGA@@B!BPRMTȹ4YWKfuiY3{ 08!O咖 ii;ҐȦshEUuKS iYU15K^͒e7>"jKl8(qvlj±Xz6baj'rs')>ouԳՐ:4>Ao%#V[)Z`)PUA/u$ {Q G]4ԋf_4jsl⋗_RS%~7':&\S:lͽlq P,FE]wO*-W-[vr\95Wǂ\upxo^RE׬ɽ6O:rɵI 44ښ>1}R]W6w 3Uw[Kگ;x>~7?S.  пIn7[niwKwZ}GpTQ^vS֩RMMKN(uuͩ;Gg^8z4_Zi]ӆJM{9-?"ݗ~Ez鷦/J'}['2<m2:f ʘgLō5fҘc>S&sX̲{ڜ-!8{?{2{zR}Dz  ے|֞ gͮ'ڳp;W`\չC_-=QԳp@m,69>U:6<$?]92oLG]ܐPP'DŽ{+l2jڪCJyDчȺ^}`weCt׳ClVC F;xB\tOQ!lYj8vH5 a Rbt\flx9sU;~Տ`kٙcH=R(a;'rp%då4,-GYf[ermiIB TGe֠R 6-Sadؒ܇A%k0m5*p 5Y o mwoqcgE n7w-/TO鸇}Hov }{IĉSb{ ~c?ñq~9L#o>~CY.t[<|?A7<-MO>tCEspH'nv? ^ h8$S")`n(o%Zu>v,l,fXXuar/yF_a2{eۥmk[4h)s-B~!L ݁D~]pP5y<,!H0R]TW!WH9R!ːj'UAw"ϐeHq9Zasw;S<.Z H{A9^q/K/h!p淋Hr?N#r!ྃ|#r\T=U!9U""KpR߆ zeXn,b*KexRL~<0x&x8x6x[->o\\  {7}b?[w8ꖈJ*1p8''5~`g/8-oE6a~O[ xkpx7[9>op{p90(sԀ]wz?|3x0a;l`rDOOO04ޏ?< iE_Kς"W^; .Ks,.W;?Q'~ԉu?FONO]pK]@?"4%𒫾U'8*"=fybKuCJJ[%z2aŰbXf1,Y ,e2a,V KUҪaiհ2XL, S7? };x׾ )ja5ŰbXM1VS )ja5Ũ*dj XZ,FU֊QkŨ*TjR(FWԫQ(jz5J ZBVDP(*b1JX[$(˫9/>qf@\hl+F>Uj WOx5 [H x4i )OS0`e+i]jyvGzgnqoatFtuca1OI< gQ?9,x/%,"WM畎oaVc Z:G 6ح\iվ&,WZmĦ: 7)2Ck5} ,N ŧta[%>;?J>#p$8}Kܷ}KܷDLI8Ttm%b+[JKqEhpe󱅏-?n%Ϧx:8.h8^]M!SeT2UL!SeT2UL!SeTWr+'r+'r+'r+'r+'r+q<ƕ?_y+ϴӼs͵щxqU+ĹBwwcyy|3Ǟn5Ǧef,3cXf23̌ef,3cXf23̌ef,3cXf23̌ ^o}3l-Ev";dglMIv62؈M!#[dkݸ5ahXuXl; MI67X6Dz9.S- CE/,ƫX|FG73dd~,c0T< 'dSCjhR -E5t.Tu:aHUĪ"VUE*bUXUĪ"VUE*bUXUĪ".ɽn 034; n /8$XeKŪ(VEqf|wwR2pVRYjRY]rz!2kZp'q>1 'dSqN8q/l| \|_y;|8B|b\o[-,%fv܁ kwⷸsqxaC(+9=nI9Xex˱7ƭ[XըJmĦtAp<b*>OEE)z G@-8EQi=Ek`EMhF wux8J ;T|G(cp,&Yȹb9W,\񗜓WJ5˝2L>aqK\"1D%a8p/;S:Z |> xAx7uaؐU'>6L|!PwQЀhDтъ4tmhG]6qKfL.WOezS_Е]Ro4;;1Sx.tM\W*^5^}A<=L?UjlF~7fƞ ??cvh6Slf7W+|sj6fsj6fsj6fsj6ѩ"yχ1̍an n^Jb^1^=Ɲa JU"aDX%*VJU"aDX%*VJU"aDX%*VJU"aDX%*V*:S|KM蓼19]'JQ[Yo5|[*EU)JQURTU*EU)JQURTU*EU)JQURTU*EU)JQURTU*b]$FQeohxWwXW+>   9psKn8f6+ꓷQRƥ-O.}R]GîI <^x /,ƫx Kg,2Xjv-#5#a0pHkx+s*KoPw)8R\܇M 5B|b\o[o;]| \p5kp-~DG?1n9O2IJQRwn9樛n9樛n9樛n9樛n9樛n9樛n:(uF3JQRg4*R֘]֖9;Zg+޿@o,T?b)zeZLi+]/~_{+^W{+^W{+^We_,b˾XŲ/}e_,b˾XŲ/o?}O~ӷ}e_,b˾XŲ/}e_,b˾XŲ/}e_,b˾xқcO۳Bf*UTw7'4Nh8qB '4Nh8qB '4Nh8qB '4NĘ1c"D1&bLĘ1c"D1&bLĘ1c"D1&Ѿz_V{X=r!ߺ.{g~Y,Sd~͏+xFt\ѡVQD wzk^c ЫE;sLc9:DьW}KDUfq˼gQyKT^L\:iqŕWZ\iqŕWZ\iqŕWZ\iqŕWZ\iqŕWZ\iqŕWZ\iK/9K/ΔD$*'Q9I&=}x,2*#2*#2*#2*#2*#2*#2*#2*#2*#2*#2*#2c~Dńс< o޲^nI JVf}C]ai Bp_x . /Yw} ncϸK2-;Uqm v=I6;6WE)N|dx1JpHz O83 6>FJu/U_s|=V W: IjzЀ>oq}l \g =;1܇އ++ÔSv0>Oyi|#pLXvzh* WG?PW6$eUVvV/4EPtLAjRs^5qTWp;Sp;vPovPrHF5Prk0)7L Rnrk(7HAmZպj;(EAAv mv )S(PLHa PhB;(B;(GGIސ+)G"C6H'dR#YY5vaaXSXF~|aa~8âQxr!Owfﹸsq=Sxcxso)c&yzͦC(vdX^x9w}O_ӗ>}ooF3}L>W00`.x!<l,zG͖ES `mX(vomT>Z;S펝6FWɺWS #0v:+BY\[H ;e=. ezz坅ej~lZ=hT}E~nR7 Xq'bZ{{7W+Z rx< E~nUMW~|޿De#Wׯm Q80d~7<|/+]jJu+ZV٪nL-f˴٥k} u-} Υ6n8vKq[)}.UZa Y\a_2*;0tv^sUMepwY!ƅYReãe:wP5T PQvw?|v8>aQ Rjল;ʼnp2N8 gL|?/; _\]_kz| pϿxQ]]=^pp9ll\}ƹk\rƿ506:e.uٻP:GEY [4ڂ6{}[=4c:m:cNz5h]ؽwWkG:r]YHewU۪ZWU\ZZkU\x{MݫjTrՠr֫T̽*f{0{o`^-5׭Rp^R[iYEIGn2e\Uikﶱ=f֊Vo)UZEk(rvvzPޑ;f tqSieO[!BnB>N{irZ]V{RT.Bn*qdhJ4&&+FIZ>NWHim-wv۝rUkZypt?qMksI+;vwXU*ur)LV:*n9rՠjP/O6s>߉B{"~ T^Ori3 r&'grrAwotsu]Aҵt.]+ju洎ܬ 7pfY{vsg7w̕f]N׬5t:]:eNY;Q~Nج5~ _W|:_ZKri]AWkt]VWjun֠5fY.֠5b \#H]RԤ42LR(\jWt&u\1깺u:ݢN-t:ݢN)juAh)juu:DQC{8QFLȅ[U<7Ouʉ*,gKT[ x@%& P1 _fDUST)uzP%fZ/K:NӳLͤWf0w矓=kIg6+}cf Bj-b1T{CǩV[j\#l||\4fwozic;;f;ff/b/VG\zSWqqw;88Jeñ_F030v [r B*P-Tnp(BP-r,Yx-{;g!Ut*: Tx%=هd VQ!_=Inj7jҍZFYK6ٷXuF:eYVl`{ݖ2\`EO9O9O9O9O9O9O9O9{ޡޡaaޡaaa@^Oe{yyyyyyyyQ"H%vS}mggGݔmY(aYw}ܾx34) ]b˨XFҳlw r\q-ױ8߸V&专NWrc؊uˌO'qg|a{;θwgqg?>v#[0N8d" /epH4>2׈0oWɈ!G':yO?gӦ7C':INwҿо}gtQFdѰF4b#iH#F1RrgmYNxZf4bF#Tպsv9;\Y~}MC|~sce{c?V6ʢQ'?F6񴋧].ƞpoqєq>1 'dSqN8q/l| \|_y;|8B|b\o[1:Ͱ`e*x k6(XbqOIz qA?0<2~ >MT|B~:>(t|7Gn 3̢k=M)z?()ŧ:CU8z>xV̳ýOa! 'Uq{Kʢ)%~@!1DL%b*Sɧqf%^c&o'\VDߏ;= L8x"\KM| m|$? d<;o,sV"<'ds~6 sp7~{p/>܏ |='s\7~k4Ї|犊æ}hPD#p$N)8t?+_ssяqnOps'sɜy2g_3Eux䵼6P݇Cx`A-)~ c>xu/:.t\6؂60bWk5b/[^)B[(L$ FHLLLN_'ǯy~ "|KW`)Xr6i9XVU j$ZFIvEJroQ;Z~B) )1AhMJma2&s&s &sa27|{ " ꀺځA{p 8tf.Q>*G|T Q>*!G`Qb.pp'#_M'¦aӉDt"Li0iL0 0 0 0 0Ms>7Ms>7Ms^{}|>^{}:΀3vw%`(ek X}>V0z:q=a80zFq=a80zFq=a80zFq=&M&BgɳYh,4y< M&2 \xxovjGQ5F}ԨQ>jGQ5[u"x d x@ix4b,b,b,7rF.x#o\7rF.Eh5|Vj>ZGh5|o{>P .2P uExH.EU'P <(<ߨH9ytQ ѥv@pgtQ w@}'[m:ב3@'p&81&3]8wQ zGom2P( C?)5@ML@ML@E"2PPGEQqTDGEQqTDGEQqTDGEQqTDGEĝDyYY U*\,]ʦ=0C8j#ڈ;y^)(#@Y~"{Ioe)U=U28:9ڏAJ[LZP+jCxV<ԊZP+jCxV<ԊZP+jCxV<ԊZP+jCxV\ԊZqQ+.jEV\ԊZqQ+.jEV\ԊZqQ+.jEV\ԊZqQ+.jEV\Ԋ+e?ŦF_ō 1,.1nCč敢9,d}ߔsr 1VRY;X4^)w꽢D:_|m`~F:0ց:2eVђFh,=K~TLM\?if1B],.`O3 ,^a‘9 ˕6J*ZX+89Τ\jOXUxxZcxB`wm7E3#SEk3[_l.W9=Dv#~.^t>q+Gx#Tc=$H|w]F{aY"l  < Rt:뵢 ^$I0d?Ӭz7pr5@MP u@]P @C 4'%hZ6-h#`O,0d0 >+"k<5 ւu`=ؠؒ؋M87٠ ss=3󱙏EKK@՜mA.QZU z4M@+]Z6-hEjVAԋܥ;z3_.pޢ`#yr 7z}b] k[zK=2q,`X V8A>X`-Xփ `#6l@!(P |q3zKҳ97Í̻^&GV[Ԇ e\jb~xR(($$TyK<xt%ͥ|zZI>顜v[A,!q?pQ9uNhIVAUZmӎ'7\VyaI ׶%׭,guCRpWU\5`d ׼z&loe1`VEQE^NcACXebbv, Vً Ǻ`ͱ.VBVTVՠU*LV+jFD[R:gXhbHB**"Pf 6p"@ sssw'3}wbFSd\~|=%l5Vh5V°Ua\FM`>at7'1̿~KmBc\m\cn5&;̝f񦉆6c7L-44>J&3'=cL)lYK2d=L-lc|."y`|);ʎWXˬ\s*4vXڜI$"5"5:z{ 懑oΊ2F|m΋|Μ9`fG*"m[\fG숙c+;̵k 5v#nb77 f},STSIal5;di~~I^flOߔWS=ݞ.g3doy=L^gϳ"yTdW~vVbo6{jﰋ0[{>[%)OާS,.T ru|QT=u|Eݨn[-j A-u.nFC5AM՟SrzV='P/IrTKտԿjooRS5]MkLHS9*.KzU S;!_i'brbVmg3ªt8gyyjw;9Y-KVk55u3sYg8NY|a,srJ<'ɳ.p8kzrJooKn ˣ]]+ݢݬ+==V4~5Au!! bn{Ӻ5656n {058636ˊeYY---}kݙd'%[&5Njie&N:z=)5i55iXjkiҚIuϏ\rGƸ#Wi7ݙ'l7˝sE ܯ" 7YvWGVkܵwܢfw"^<=N/%GʼZ^,R䵈Tz6ylε-]˻Ȼn]u{WzWͼvszb` o7>፰;{ vo}㭲/}[o6y쫽mx.+o$Iվ=yPm)]S.G 3:/)ɢM^z.N }J}~KCj,IsHa{i%Kd;δ'xF>a #o&HiّԎ]73s/>F1őw zVDTD-V@L߱>G~[ͪwpqc2zeDXW|m?^!tMw黏Z#c֖`;Rs(9®.)Qe?dht1.u.5/G' Ue~o9UTBUJ9ܵ8Rm~bG>/{Uݫq&pQy';Yc燭wWQ%埣jӟEj^`G߀BFJϿs55/h_gw׎|g9"[P 1("߉A-n1n%$~^#ƙ̭ 7w'XZd{})yP<A,- bi7\6/[%9P/[3P-^ԋK\^l!rBH,W1+K .FS A%6w Kl .#]bgwA%*&kaW?hw)Ae.˨]F[CF"IvjN]id r:͍!N q9ftt:8;QDYoMM0 % 111.i~jAdbLv 0>bcaH> MAl`lbckAl`|7Al`b`@oɽ3Ur[XJn~h1Fh1&3 M2Ydb/7o%SAocOvhO6n Vê$$'jZ֋dAl'ϟZ[>Jn-C"k4HZZE5̻K7ZQhnMfon1VIhC{mk^ZԦ%]jMD]lWv#(v\'-kn5$=ntSlz0V0"kVHʬݢ+R}Vhnۄ"7 ihMkD[IZuuFrT97R}Tᨛ''h{ %)`L2{C )j&ڨ좚."]t?ƨ3V#0x(Ac%D'?D=#xA5LIeZMQS9י??aX?-OSgN͙j&9Oi;Kbf<9\&"f3*N&oVE[Ij*eMw[-^Mr_VF<1ghbc8h㘎) 1'D؎-(Q%oQӉ91h G؄#l6pM8&a ,sqqrpNF)…Sp̎-5ffi"\Lxns|Q#`ai/j{x:ީީNN^JON ^G;;?;:zRҝ.ww!uzݨsw{$r{ɇ8zp]-jb׈^oZQ׻λg4frz3(y3Ļ9= %=Fppp9[mRj=>wzD݀ PPԀޭfgx#l"A`|4 OŬ ^J`~w yNȃuCP3dSќ~Jқ;M>gz.tY/fֆᓄeQdxXz,ꄽW?~~? nDhl;:͚n;TP/cUװ ΑTТ:Rz;2>vUy<_+zZqT^^g-;T}U=k᜙1Oj/F3ջQ+!&8/.~>ܣ㎱UoaU#GZ?OΪ'z ^ף~H?7m_zs{Y=@d;Iadgzs9滎@E=mK#N~|آLUARk½6GSaIN꧌c;j^?FCу0Q_#7iBu7?fr1 o<׽ -/`c.-Y+X?}7[K }Wuf{0wU߬i,QoWpnx K\gxTG{zT'y_ofk_CݗWQ]{gI2&"B1AB7򳨭R**u_(GQRA@de"Q@29%y}i?y'ߙ{̛ɿ ?ڋ{]@ʒ~˿2X΄c%dwjJ&쩱oofvW}޺7~&dk}-]O|G-6祿&HҮ)Eʷpyxop leFsG0\D+ _ Dhez^K6X['53ccuU9E 7\111 ]2Z_[k,ab%E.VW+sop02ϱ]] w5Ǣ9|5 GI#/ˌ‡yR]RZ7E+X6s^,蜟~=&m"6WT? .)|(p ~f"wVxqτ ºᤰ O['GKn ߦ_jyge%;!bn:%~7O`;G1fɎh+>?ͺ9m?=Žn=Gȷ!;{?lLl#ӿrq>{C= K9z.mu^jkQQ\ҟ XY8; wϳS5G8ά>._bO I9e=gwGrϋ,9MvYNœѐ| 8؊褷*|Y{iZo7 {uA|1sB웄7y^D[v^D]Ey/ev ~̹[#{X#G^z\"'W*]&\An4tI 煷X&rVƻi;9Ci|֍9;E=Cgk K>pz }Z:nLBah˵aplxu웄NS7sf*r]e9$]t>Xxci7 '<ڸCʘp l9w=k&#Djv5bx%)=yWԊ/– )纰7掼%N _Ž/&)ԧb3%͢ = ;]YsK1 ɟ~ԇZRU´Ja|,v;R%h=pxs|V"+P[׿Чϵ&F,]r.~1.at0ܢ*tpIUW7h = *ՓgE2 Ĭ*Ĝ*cefUqjƺ t6`Vv4YUhB_I {zW߫Hh~UJK?TZg9Zߦ5z^@Z?^M5\?z@̉B_XU0 mc6mհj^fC[VtjcoV{:hu:!unn=~d3OiϱS37an)QNSIfՑJPz0CJTOf(QDuBkDgVf%Qw1+Ĭ$j0D`V,J&2+YIZf%Q뙕Dm`VL2f%QۘDmgVYINf%Q{DeVYIf%Q0+YIOJ3+:$Z3+vD0+̬$FninI-܊nrUu[í[uݺms5Df݆YCt{f 5Dwb}}LwaݕCt7ݙ;D结)sjFQ#lh=ĆZ6t"“`I’.vjZJ2*b[5lkdsXX#6U, *X\u6 [v"eIzUo)TYOͭ"6J!߅(2`y?\ [ w ' W+\Up5IT*oVXVbkE\r5˵.W]nֹXjbN6ӧi#{ڊn Ke^+Q{=~~ʰrs>NXsbkNl!K;))㔡zlө>l//JFAlnh8{쥈>g5Rx @C!*vS{RuҜc1*k &hnQlTc!߸ƣ4,S” %\SҔSʔF2 Y)˙r(9ݤ# V*UV6U5LM L-S%1ui2QBH4Ef1Y& 9&dgZҴD\ZVHڴF6 zuu0h:#rt'\iBʞ'E//ku&f j܎Z0w= 63 Ey Ra*m1ї'̓()Jx<(//apG*KR]/Py2־x3ʙWyͼFYfd&Aa&za%F.ĐXJoޅ1Rb=Cf5Uf=o2P Ե|ڷTl3ۨn#=VnkWH|ߛ'R@QrZA "")=R%RFGjSHH}5)eEE]y$EZDZ@ɥX[#MHĶ(K bFB- %^3Ȁ322222222 #2ڌ 2,FH d $5dd@ &#w 5>E;۝4@ =PR.sA.wCzr H@@ |~-6vF-Ԏ15ȡrI-ZR:# Ha H H {'FORjJG:ɇ0!XRPI`tKOHqt7#ҌH H _^ xoj1>H3>>#J2>ҺNϴ 3aQx{dYVAZ nJ *#H rq{=̎avdsavd#{Sd#{f_0;9esWÜ&{=e󕲇9O0+R<@]T.WQꩮTo)PsurB>u{SH9(j" 9KΛC,cA0_G`d ОI@{W ]ֶ.!K.R˺ |A-IjlSpaAuM^&࿚z^ ȯ^Bhܮ?_S~]٢ީwAGd~ ]M {k¼ӻIG{W'tH뻪,0a9^UvWRhJqf l, VE+zƝVuV-L zV=qB6Q+jpCV.ŒJYJ3vV;Ϩ4S/< v}<ϱ?7;)T^g=%^bvA;Kwd_/d_z.JMsF0',pk~gA]q8 ,pN10$ SvLMLiMA5vh) :$.,+` 2 vῶ-R7푒Q`'FОguTEP] ҂++r92(` Fo9e2qfۚ nkk^7SGAlYf2[bp2Lj62Q|b>Auf0lJ]S` P#F^GAxAخ9bA/[^NDG4]IC2kW aym絍dF1 hjA{w vvT>1q^Gy"#Q&'ž{/ '8ž$ ݅='rC p(¡U8҄C!O8҅C!]8PpC_88|P¡. p(¡q(8¡ # i¡. p(¡ǡ/ y¡ǡBp(¡B^# p(8¡ # p(¡¡U8҄C P. W Bp( # ]Cp(q(8¡. zFYmBmspV@俥\..v۽`*/=˽#3>ru|}r,JH3IܿǷr_r_q|55uu0d? 09\6rCwwy]/uF入&K}](\wrg orwAjgA7ň{=4߻G(Wܤ\yF9I:P.I]誤I]xI=z {9I=z"|5<ܤ_& @{:&]t=O!F ^AvI7C3 iW0& 0>8'fbDj<-y3gBN 9/y$f֌šQJX3J kF a(!%>C~ʯRn)#RFQI) pjE:gߠ77xӛ@lo|o>4\-Aquu_'@{둞q]oW/kW_Ee.oez{=_y_A2o* p#[﨡Fo1'#eRkߢLm'7h(^AS zؒ~i7h#%{M*~U/A_ݯjC_˯EOh cRO0IU?FMjIUa6'&U٤0$eNrRϿܿa:w!̌'-)CxO* [Rz–Tǿ-I}ֿC%|(eVzŠRCXQj +J5VV27J F*(i4xAU_*/g5| 5/[0b 5[f±RQ8V J-X!+6)g+ўTY8[zT`[a|[UlGppZ:qnp6i1$獞r|n_]T Ps0)n @["gpF8#x? ~pzufn_K߉{GD(pDjH[哊R:*%gIUa01|?|?x#\&|S 3E9W|\(r"WL&E!uG4{E~#[EyLd2iXROI;`Q=`9RU\'3D3SX8#%&ė=Q8F ؠx^Gq^ŸDp=]LJ N9 #> Iv]?}S=~XGe,kI|EqMOzOr_!-'tSW6(dW"fK.aďLM<FѹɧіpSD{Q>& -pح hDâM8Z1oNQqt8[gM43bkOeg,W~tMNwO:/pxᔶC/ey(W:a[JɝH_{Gh|2iҜJܐ :91-cef)X ޤT`sDN`ժUҖ`/V}?T:])ӵ(<eLgྫྷX__^' +DndSЂR҂Rht`L fQR0jr0-+9?=|uЙÚ*, e2<+ i`J(XZ>֠矠O!a`=Z+||r6QXM&9،NFg+o w;.vʨ¨Py|LZ# +Gy/N WdQMAN8X'XX{2)2)cm:"Hu$ɈGd]$Hv0񈌸7qWF<OȈʈG4kG:M: cve0М<&n|#~ˁJ汎X2I B˸Gd]@=I="*;m$>u!s'gH|-x Gԁ@h;S R93=ZNI:Z@<ِs/b9'H|'}5P~/}oܛx_kl%̋zqDncaYaRGӘVC ڒL1&k*AG}4kv~Zk56!f:֘XCj=}eX9zugN̑Vkm?NZV}Gr!ݬTqB ﬌-t2zՋ´THz]r5zQf5 11gn=0A r4V*^ 1貺IVTtmةra9zU8UNшqtZ:>b^j q("⮟ 1DuujbC]*AvS CQ }7ݣGaQZ'4݂3 cZQRQL3ෘiwwaF܃> `Uz(x#XǜL c6z2S?IrCӐz0gsmw/ ,*)bU[MWDj`+x],8 g([cvvLE/& O bRK/2YzI/KH/eeYeyeEeFQqг,immcX+<\gyH8H,l9ncF9S*aAj=Ӟ(ws}lg=8qkqCmH9?.Pg}}+bW!v(ŵ׆dOE\>gX\vo;xD:Ns t˙lpUrZNfq^{Zcٹh~uRG' o.k⑱푌-x0\٢vĬAX{a\Yyp/[a5{ghq,; > ux=i+]`SF;ն[V `A[9% p/Yb3Z~]OI[[mW$k飈[j5\H*. kq녈i9ux]ci=3GgXɀ~5^qXJkx5qq=˰ro8+y'{>aTKM ( VLՓzN<(ͱ|n8?;Plz^s*_zRqkT_`踖TXhaq+kqJ;r-1JVGX΍k/Vj\j1֘ɲkX\KOM.4 _6kGG R| u\}(W1qrU.UVM_؟31uR|x)EFHWI)rR^Y+nUB'cW3OtݓPw_n1]}q!W/i" lKlViqZƩk I6ygzHn!vFzVt= 4Tg\ta"݅Qoϊ|4nwv;M۝Q<[dBȑg3+OnIYCp<4Y'*UU iӊLiGR Gߔe[~;\9ۄf/ÃeJ!I:I3o~ymۚ;oޡy' l~F~: sw7̿3p}?2L sr! =BdXB!%,a !hf4#fBB!P/!x a E¹qsXBòuX^Px8/rG8uK^6?z~ͨݲzttttȴn2=1=3E$X1^LS 1[ Q+r(ZE 1u#Ő"b/"#ֆ18-Bڂ(.⊸*6mqW7aYaV5sro4s9'|s4ᾲʹ7Kf[$=fkDLΘM>86̰9s,/̽<1#! D8n4τs ,2 (xH2&$l&k MKd2LCŸf1 Ii4gnim ǦM8sbOM`[6]#b9w6X7jZ.qIl[LSM1B鶘^|+h-<"lzo.I¡pbTF1f2٦3a7K7JF2z8k%H2C`R4=!XǶ'_vg2!@$wg(VFqЈ0) q0#́&_KQpK7^"Y!MxqAFJ-1MD$A+p(XBHhڅNG Wia/$}IXVUaM]aLȓF>+8?:k9{{}>-b`u ;k s.Uzlu)MlaG`}x>ggoqmRGF-=ڣۘGYg~G/1O^ۇruUl5 Ħs%2c V+=m=J{Xa`w3[: t[/Nli~;NJo<{@{P;a1R3e/?3h*AXGU?x*JXvSН_M*GTeTN$io/\g(t>W_PbL3tiq[ۧ7-fQo/׻:8]_;mۧ/}D__я'-0y^xa;>\K7?F;D&ߒy~JG|e]juRB @WA t EhZ6@۠]!!)hj=i@ dP(. M-$@9^Pn] /Ӥ@#a[Kπ ~EZX7A#iwA##z&h:}|ǀHcPoS -AekgA=}A}jCwo;_]&@S A7@@w@"gZl#筟ٿzz:#bA@$+q`Ra6&T~LId[wg AV c`Bt鉼;8HŒL+_ u%::+ZDҵu]?pP7 guݢnI[ѭt/⻺= {;}5t#)tI"E苁eVC#ZfВu Z2 b[;@rO>үOc$"e!ҙ$T&fBe8HV0~`i3/303\eYfYdr$eY f9aXqjlE/eig%y^>=CzeC󤷀3@|B=! !b8.KaӸt. x1Wd8#g}\xk:n2(7[=[綸'3 2ZK)b B6BCA5ph5h =!dh1v{H aa8kXK_6V k ag8^y 'L>RyBt^ *[K.8Y#8?su& ?n;S~?R8qtB!QH҅,!W%BPt!4 .$"&t>e pTN ׀ pGuaKx"<#")F$U8k7&Sl¼q^h,1jQ4Z80z~cbl7v{ A0px8m.Keq]3n=Ĥ0D)x_7%LSTJH㹷3oijp98p4 !q<7@fLwMxni,ܑ9u𬚘.fb2F"E7GA&vbxYB8 , y xz >-L<H<0̱xs0՜6mB̙E0{~͝s?p< 3_%VyּEyټb^57]|bJÔZH RfvHR0_*"L3O:",h$&I.+f0 tU$uI$> I#Ҹ4)Ip\Y֋6 -V'q=cY/:z؉ku:eʷ^o@ɟ޲ޱ޳>>[OϬ TխVW$Ԋl냊 =lϱR͆ʸD`Je~ʬ`qeY%SiT+ݕ ##/Vw+;*+*/cϭJ娮rr x 7*G*U3y[O*c;b*{,IT{Fߞmϣ %vVva6iCLΦ;=~}>0WY}Ѿ }ž ^:5 }7n?RTϼJSPLgVUeU9UEG]UTUZEG<߯*[ $|WUUUIjjHU5R50xUU3Usa:MW,Tݭ|֪DŽU;UOÞj~Qsfϡt0{8jH {t,;r t;8 x:96GI|Kx.>ˎ+QDŽtLA 5昇v3[;{lK%#ǺcDJpK\6py]`Uw]ru{]2& n)\s뮛ۮ?/Qzhkşص ״}y^ ::NU'VSYչeLRmVv}mݸLyjS=TVq^F3^ު~K$7X>>v_VOw'S$M>ׁ;](< +ܜ[t[^D:r;-Ot[yw{=,c@Hi| {pp Se0+Uhw7RC;u-=F]y&bhk H>Ldjk,bMi mk$@U 4״\Ԍ553ؚњ5k1aÚ55;5Oa~<(=18OaI{=Y\>Sz=ecXW"⺽l~%O{pϛpzuaԛ $}%o7zL>΂aۗo>yKJ3^}omK.S;xǽw;}Cc;ާ}5C{D'0*u1a%Bu)Yj]z]y[[WPW2_3s^, u:w낄:>Brݕpnpp\7/ݨ˘u= +S!R}(c K"L%eG_ħ5^>)y~_Ȕk"\|=_ owx‘ E÷[C=uԊmUߚo÷ae^wzM}&ē3sE/XZORU}@}s}k ?1c;Ix<[쨿_qfNc)l߯?WcqDV@?˟/2?7-nAE qB8O7wjSjSmݿ35bK ISېڐamnk(l(i6p ba6x,b!d)ihih7zڇiYr]j_s/47 6 75\fV|+ |ZF}kvn^aI@P4@r d+9gERp@9 Cx`20 \  < < lvOMƘƸ?Әޘ՘XXX4-Fw1x?ˍW,Sɍ~[wϮ^G[' I`F0;lx$rA1h :? w`c"8֏ǂWBp1\6+Zp# 'M n_jR7iGҚ2r U&Ij5lMަ@Sh ֦KM]RiSo@PHxdL\M6&6ݖ-M6=nlڱ,5=475=)C1Pb(% Bš2q ^!_(Bx%~㰏l|ہ->2 ]]  \T쓱ем>3tC|N~l SBwCB½Уzh+ļ@ *G!g!RPԿ %sTs zI6E,z"N2zE":HVHWCx?zE5ЫQ\%(\ǹϢs?}i|(M3D͟k<uלGy| zwcAJt^FV6dC^dF>EB ]F=h@?BЏT,vs< EQTPRJ^*꣮P5B} oSmV姨O+g}/R/)Du)SO:գUQ_P^W~P~O=jPʿDV\UrCIrGԘ'ʟPʟ)7*.WϽJ}?Դ*zԁC"g *sI%**IUPT~FդjV.:iϩP}Y5jT5ꛪ9WSXT7T(WzRvT;?Vv(DUxE_"%RzsO+;x==}5QowDu^7Q)WʌތqTAiTQZWGQ֗>RCԏ_8AMl`I#ϔ7\y]yO>|bQ|C߱-KB֒lIdZr,".Zw$[$xywR3sΥ~NEAICJ4C4|wՒ[o!JmŷB1K8sd$ 5Y%Q Y')vŏ?B6yO?7~EEQ(! WEPbTlT,JJJDjFʊB"kfFD4Z{ʢ.t`Y}b׿ Re2 cƎxc;;xK .oEďa1_ģxl,ųx,~KLh1-gocxE%c$qG?\E}܀.ZN'^g(G~e'I@+Q&}t@FAM~%T!Bx8+@^k 9Zn>Z+3z}CH:K+ޅ !9woAx!dBxt,5m'9>'\?9Q *P1P?5>c*!kR{k{"YƿLPc:CUSR^ʋޙtkBT'O 3) Ignd١H '5H jޭjZQDW䣖C~奔G j$ fR_T_D k\TZݎ#Iu {=Sd6j̧SoϨ&cx_XD%RAeG*DN)^JR )[ʓ I+qJ#"KR/ JҘtUfiQZiUZ6miWړ/̦5r,ər/ɥ2- '$do[KrzyHIyF7aC)O!G&S $4_L" Y97A8OJ{)/RHiDRړHiO&ҞJJIiO#=ҞAJHi$Ii?ZM2C|.)H|)$eCʼRJJ>BJ{)ԻT(iT8)FJ{YUC -):RiR3P?8s琁Ǔr.rnL} \du?+ꯐLJv+9dSQ"zB= ˜q]quJ/"dnuA}ˠ+QNSln7w{~1d Ϻ7 -E2,ܿ-|6\:<[~1RQdގ&1KJPJ9u+=_)NbXqzAً:9#'kOR>z7{ $K?.dN_;wH{A{R9'f~iz`4vP ϰ-_mK=V|l3mzMlmx3*SO9 =VUz杳EϻO~ڭ/>s:\rk'z9z.K>׺sb=:ћ\SRklژ57WI3{.kSr"^ ?^[Y$/;~hoBw:Nklj]M^ûӕZ#Y3SkIk忬u2y>bAZzxuQF: 7N|?~na[;4rw}#E=CEj[ң8׳M9Rܢ|22~;%e?:l{ sp|K@IN\mH@v)d6T{S׿u&wKy'OyR<,z$c=zCrrƬ3GϷRKwGM1wN z{ =rOM̛*/yoEeۦwS)oL]<뷹`*;J.uYR9fys3^'_6:wcVZON[vIoIXymѻ;E)=yk\;t"IFsΎ?oKmp?W-Y~\1Bh|wzJc/壋h/r[Dz*qo{? jI]jXڜBonŏm{Gퟂ EU 2 4(8ϽݣOq=?]q |k0_4F8:]] f w/Fgsnf<`,xB!s-Ўpƕ  <4dfxߡsV2*N8OO_pށ>]x /#g$_zܼmqkWh6Scԃ3{),#(c2,JKPloE_ e33pi7̅0e1 c+Pfw31rw_ǷP|(cx,ot %h> 5P׳9`^f"0Y.Y浆1V(#[ ߁7Ood5?{8[[K ̅ ]MW3_wKXOׁ7?Gσ!Z3}i 7D\(?\|JCw$zlY}PR%$5fág},nu2_{2>Ыo3/U([ x47T5~q"\i!!jnκ| /׆2JF5kIVdG@ᰞfYCA>3c0E)d*q`5"$q& V{A>8ݸ.['(6S0 ZBc0LT7Dp0c0:pOn]veA :'eD2FJX  Ɏ¾e8߀-BX *^[M֌-qFbF~0R$Y[G9^@A=[ d2ԥ.Ѱ(0 9}$2gAY 2B^X Vyfz <>7pr +i@dXI 18=x#u! -5SW@7D Q5eƍȸ {[@te]{}-m n> ~f\p{p+eϷ< oAʖ6w ^Z q.jP!l;h0ΡlWN?St7>}g4p$B[P.h$G6VbnjumE-~U ;`a=l@cuA̦7͐2h:wJ?NIm}M`_Jp~WIZ}Bi䇫(;)E4:/Yg!xxxxx?x?XPL+~j>;25V`TLrY VjŪp9=7 '7S|8 ?1/*?!O,LXKF_; gB;IB ~43P@\A/Q7pZ81fL#d9rkY Vm?11S~!=iQ3K0(1{Ghl+3^4 m-~G"peR.#e; J;ꋚXeap:V@twlXUM͒־жmHC-2Ddyh'Z1t5mDWNq5mD?ÆvpМ5nE~髲v}ߪ( aci0-hEKEXWԴlKnlw!r-6΋-RߙGD-ިuG"peeUBms޻VѲ὎Ծڷ:5Æ__]D/_D*"V!񂀑"}9k6U]Ees$OO"p"_\\OC cؗôt'>v(Z_AGj:'OGt$XFruYHB2"33+{p?ÆH;343Lc<43L;f~Q奞x PW5H84rkiHuYEnѮτqh9wwwig >H.`g oU"7Z+  JrWԯV܊Y`A*Q)5bS-hQeB[e6h6Z)!Z]yܵpOz{/R \G]G+X=->WVy.ZλDMZLS}4ג幫b.2OFH+.IV: MQJq|iL}]~KzL"9z[fV|Е 3gghXmck׀Wէ]ԃa}1#[/e5aFLC aQ^ 2JoA, _hd!CNH.vt->`D;E#p%'~OUiKUCmȤӃ[q+ơ+KgNmc̩x,Y7& ?B"GrQ91Z9\5ZR CRڵb8yZO['9HPU?6Ò<ۮ좯3G1ȷHYk.v-]Oj)ӀspZ+c;YBrhPFp7Ӣ7mK u7:@\]͢#8P2ܭ#T_4 N1}9WBxG6TJmWp]8 ):s=wSh;DYQNNp^'c{Du#ͅ|*5~cٲ/: XA]s$1N8]RQkdQj4ҋ/ V#Uo g?ۻ߱F9C0!xvl\~/3n3}(ZE[fcϹ]sl§p#2Jeat|tn؆7} D:x)8QJc -U$cgZEyH,=6Y+Jֲ$6=nh kj`gZ!ΜKa}r~vHfgwL5.Y_e gEb*\q*1|;q`?m,w27p;а;yn,~Ee)~Y/tgd?n N8h勰),OK,'On'gwvv3nw l< 8gY+Qn3kb[^ ]"h"S5*>N1ZA+kKengĘk݊W6sS;" mYE&=)vSjb<3g1$Dxv7XiX83>bHnfF @g[ϵ':_.iUi(R2fq&Lr3-NraB/k:M:|wǟwc)C&;}mМp[g‡,geIkz>I6WK]QXSgw¾;gbkD So{w^mZGG::P?mh!eAxFr&l3?=#Г`"44y { ^ F%S՜օ3CT83XSh8 E79߈ %n#_rNXsΨ>nUηҳxՆ'7sŒVc#m+UWШs  CIcVC9yn/9ko+o47;H3\e%_Wӎrٛs"w6Ӈt8+|{(y`ˍb鬨mdfȳ #F-ۈZ v}s}27S y12Myp*#ߒsʜK3"+ vxL/9~Ԧ56SqU)2=%v>J O8UdE??"^=ͅϤ]%Wg'!kA#i#݅"t<|=|1ϡ)@4ܜE{toa]h>r? 00·%gI+o:rp{YK-=K50k/el8k+:5pv 'bֈ>’dkdב_9G9a- ~wYe׎kYym-a/⋱>}*uIރ \ ے3ͥ3 .¶5x*,5n$G"'ⰪNWJhd΢ƽyɻ.e,Us$}RfFVO5_bxc8mdY xl%g8%%LwkE(rd62O/nad2z1ynɦ_<"Ü`qNx#Cs,UGgA r bNd^5 Z]d!Sם˽ݓhd.`Fx>IZUF{v:=2Qv&+YO?;'iTl#|g9ZYƄWXG1J-[|c<1E n$ې̩ 8$9jd̲ͅrnք!|)-v)OEmtm4XelH]/xv¹5P祽Eٔ:NJWqwo_ΰg-M؛B2V' v޸opkI1q{j&`2pTa,f9?*T_QQaw9{#Fz?P*h+F tUS} ^~g[~yJ Z)A$GBRjt t$@g;yoO0D`dN K{|xQ0X-Pjh<IJ:߇01|o1Ch//AJ?\L_uG12&c특v A?-a; m߅RMH.Cr= N^L3PƵzZq=NƩ88n n<=kסdf#3L m4KK)˨ u"F"`S@tPv xxO)OP sm (*: g1Oz!10t="FaXrE,7i+J7J+j =UF'z"7/꺗EQO9C3yqц10#މ3ݚ87,OJItLtM& },헸%1(;kHbxSqI3s K+%%6$%v$v%%~LI'steYe,_V*YYud"++뒬Y-ꞕuu58k@5"ɬ1Ym5%kZ̬yXiBޡV[m_{x|eO^yJW+3_z7_:گk?|k?oͷ[~ߐo7[ow.[~s!ڿ__ܿ//Ke|q_˯]k{m~;ߞ/w~'ߙ//wW{|q?/92MfNϜmo e,]ɉߖ3$'2߲cq;R'~N;7,:ku=/D'!}ebX',tGE輔+[ۢ;݂HetO)?z5q`DEY73c9U >*U,V,&k@=>bsE3GnwTžȊ;ͶSǣ*qTdyYcU8Lc؉RY/TT\k+>z>\_Hn)zjw-qj:=鱕;>-͈'y(~4~"M;V1'xOX@ft\jc._\}s:IjlaeJo\/HL&>痲N^Br~<'s@y\_r?"J}#CK/9O`8aa au_+xTS>ST?4775&"uPJ7/ ݠ뼼lM_IBs{Isaq90iYe}Fs;T]d/㩜{PctE?WucpBz?0Q u>XRY2i]S~F]Nm]~I&U*_?]xwq:ܝ?$^͟肮~2Wn+#aJE&naZÅS5M8SgFl[j& uGQ gapٍ5A8& saZ_5VK{as'+KoK2W?wax=^PNxQRݪ>1i/n%J7" cA׵nlNBstYK5LjRt[T1Y=[ rc bLPíIƕkxs}\n=@/I;q]Z[*on@Sw\Z/qE.`rq21P_Zty &vsKk?+Υzs$..ѥk@٥[X/nvwCQ .\Z\vZ4n]ZDh]ɐʏQ#9'M4ZDJg"К&2\ύК&2FqM6(Gj$NNtW;fv̼w/]5hk e0"<00000000LAMG8H8B8N8E8KТyVM Bķ}lB.!չ& $HeD4B-aa_=a!I忔pppppN/&ſL·TkIx CȻqq a]Pp(iKg:gn3PM!fK~jOepN_wL's :g3q;jBSv9 32gtl[uqcIs޹\qPj(3'?4 9PY(NAuϚWojZ2 Mޤ\.4 BamdxFxA#e^;}S}}޷HooCiD{w_tY,V5dfŴK}T]١K^#/#Ngss#qsֹ@kqv^h_uvZCF(=hqvmwnP 40T a~ Uƅ&v{ǹCyF9vK,*9zd++Z/~czk-jeߧёieef?61-_<`2<4j1O4ۼ;M+4&9N{5kUI3":d3E4+ZV|m_Q%b󱙼 wrKA{[v}5x12Ol=Ns_v'|-8N79NINFv0H*0L  gSLsjY\kS,tfcpYWt]˯@{C6s6:[EmdY7YwƜΉvdsN>Es.: ۜDp[*72Cvf('A |˻E66_B e +Cvژ~k!.; M U&; jф<}h{ygLzB7̙z֜ϙ Z/sO1l6jokeG#[3ikz}}{5}{ {7o>;k:%$ǩ* t=(P'F|hG`|`R큚@]`6~ 4o 4珿{W`Y#[{'{,*h*8S8?>p`a_ jl3}A'|?9X+GGǢ|e('!)H-/ N2~hQpjpzpfAn \^FpNp>b]X\e, K܅ 3\¼ntƬaΠƜE=yyi ǿe~ۗ͗.CqXDkvolm-zӪkZu1A5y+xOuF k]5gAa_i\ST]TwluW x[ԼΞꁞ@ODOebٳ_ Bٿÿۿh_s'/2o >q>|J5Z\b.NGXrR][z2i,9pXb7HWH٠9z b)zL$r81*}9xZ pf{:ldAw͑JF+&K}c |qV -֮r7Su8^é97U 4pHuD>|-\Lr;f^~z;oFsQ GL|%^Z,3 u7vr)%/PuH1l5]"BїQ(gC(;sR6)XzIj@ik"5(Y< M,j30/Ax29_S>D+i~Βڹ%o< yq!B<藰<B[>e&$x)k -| HJq4t䖆19ϭ9lppճe Ԯ9F U;hu0!OA>qvB3 Z@nV3|ZMLF[w6ڷQ/yhwK#b&&k*>Zk’f _T h([1T h%)1Č(.bZ6^h=h."yf$'oU}a]V#$ԳC?a۫bKF@ G,k]isl,y]sܻ1 Eze ?CxG|OGs u[$hj<1k8A?[mW#jT'm/mfog"P(};<:a^z((^}/B2 5BjD[N P Y P(܄G(>(5(Y\#( X)P8'(,'l'~'~}',}ϧLF{g·'L{±'zWO",zŸ3O' yXOXvV~'wN#vNc' v]'uT'uN'tH',t?'s9g<1-'r''LrCN-&\q%NN,D&nMX܄Q8&6ab6a_5ŸT*j¬&jM G=y Bp=2iVQ"5iv`8致:l-jC0dwdoȇ!G_!iݒ5Qx_)s ~Z_bf"i6'Iw(/!|%1kX })rÝ$W0WV_kL &+>QKa*I*Kz;#g9 lTӞVEنISyMsWOFn&b|.m(^lC:3[GSeZ=8/O XUii͜|?z?*XĂWQ~#ܐҮ臧HI= OOC+'1=i é_b G>O!~u7ŃVΉAI|C.?ȇS`WG X͜Կwm@Y~&u跐| e+jKKq#$A?HŷfӥQg1ė-$k'K;WOnVh؇Ѱ {xqm}pҶ.帊m$vT+6U i`V߅8%e!B ;҆Ü|wM>$ K()0 7m U{X lOχNA":dYBmێ'ȭ6Q ߱ێ3Q  {*rDhosAп 7 /B~RzUȷ!@-$r0f۟G}՚!^&OC]iAIwPS&$,v)9 ~m`c=2u騩)s 'A'N/ڧFױco`6xWD[9 20J{B r(4ˍ~G{HO)oxS؃=7SFj z?qУ ž=b[00jty7K6*a [;)Nj`yQ;אd/䅽1 6i*_VO X$ Y뿃FҶk!DzƋyʐ/5akS453f=؃X,fǹ$~/Q3Z 1Z=x;f`<+s) 1a}a1r]"fxeg՚*Ʃ[2<2ЏSx3eJ'C;\)dD㭄.ox1"t@ǃUh%ň#V r*f1xW 5ŪÃ2pY2:/zNCb\{1y3k~i=x*y/"&=)k$hɃ^̡yvv,${K`eAk-r*m ͋K0$m軶A`kI`6lCyZm3mmxskBf%_V&0'0xنq@$_Z O@mنwd m^*Hc҆gl뚆;g-z6Zܝ=#fi}Td={|#7E+~"5#{rCyI@>Fg4?IK'A/PRfl+ XSnMFMrk=_}5C7X3o~[>Pܫz s(Ծܷ7H'TgͨlX7m̓OϨ<85}}Ǒ͜1n'f=E)>T|_ا~Gg=t]~Ճ.pGenq!!C&p/)Y|g_G?V5fpH~}iOC=::R^vC;}rpQq(=O} iUiг4g Lվ|ڻ[Y>**ZzhnS3}ӿܗ֔G<;;?K؂ Iyl~iЇ{>?Oo.ũ\p}}^/+\3:uw?|XQ{;,Dv&2!{60^ՠKvR,ݔ&"J-K([6__ew^|>9ck4Rɧr7N|V8IfKO,yZa4"߮W*x@'\n朐z({C ^ O2S rX4O]sRg J37{>$hi Q>SA0>ׅaTnI+-PUz a$at8}~Ijժ"(0s s^J_I[ӃQGut 8m`T*],l`b 0_~8!~HHfFxٶQGY^a D.j+L,Q7hzԛj].?~xL0`RT`>QxM @EU]C 9kbUUp۰ꪎ.T.`FyF:jJ*h t(@,^4040Z? f0(4*8,6 $ c W;`HFz'8Hyd/:Jv>Za-. )#͍82a1Y[Vuv^;QK-D㯛vuy=R`~蜴hY;4jm hOKbCrWݐG [mݼ$kW0]H.Q`{z_~O?7j*&ozQ`靝U9ktAҖAЫie} R\S1 .bqT[@9s46k KimV켛ǰ_1#ܻVMem+ڮ򖊼ܺe_X]n{-k$Sw>afŕ/s'T\@ͱ]Wm11t呑s-N~ayǐ9?4c &K=+DBv[2NudTq! *aJ\[߿'UpF.+zf:=߈x s~s I妔sMr ̎gE)Q:s͝r-m}c5eKshR!oNTIZN޼sGj b(P!뺊ƒhti]ٶۡSCЌޒ #]w$β(G1[q8$Mi߭̈́rRmf%r.tY]CIN[0@ C8t LΞzp8~ ݰN+Tb{*Cv *PB_s&"{ӧ_.@]|c8N4x4Ҋ[C>> stream x]_k0|> stream x| |TE;JHCH Ed,lB l(N\q_p7GGPtqPw l3779Uu_UzՐbܒ=?L}>-EnApxR,mDA_˟<ID&袉%U瓚DW%젿m'%CﯘX/p׊-NJdSlcW6]#XB4c%mvzJNԷή;vҴ)"a84ǂa/v w }΂y]߉&Ϛ_Ӱp0/#ߺnQUe3 璸aQ *ק[RrP9w,YZ]&?/\P$>(C_di֡}ijgwL4icm{%!1l&jKPn od0)Ćz&:B⩐-?:%xEiνVZRQJ9q_!Ml"#+*SLJQQR}\D? A7+)Zb Z#^t0C.UҿvL_>VcM2b2S5:uqU{c0Ss=8тYn]{̾iݪH NWy1~Ӷn5Ou'[~뱐yR繎uM&SjqzZV=p8LS).sr;LI4$K4XෟM;{I3 ,*?U^"*7}Gي3M?{()t=%ߢdC ~=Ϥiٙ;N0s=X|A=(Y}Xľ}oc CͧeLմNjK機iciR^8>Dŧcxr?%sJ24;QMIAvy yoD݌m'?ClB4fVUJu(m4Z?q O8)?m&*W irp)mTs6-;6 f#+rrMQ({h~g,` X,` ϘL]LL#>o531,` X,` X8),` X,` X1!@2tzߣF3~\`4:}{,` X,` X4Տ.p!ԃd1F-Z 9'epE\:}v~$J8"ѕvXюΎ\Gc"~6ԃixhU|=/FoccɲS딨*i5_IZׁ}Uپu[Z/^KshT=-u5ѯUǪת;Uڠz:uz@ZF=~~C^NVo EQb0fgAu3¦7~gmv(*PvS\T{vYz|Pr*Z#ϳˁU4-EY/o"js COW }fTզ7Joɰ9.Y}M\9V-!‹LVbt]0Ţ`H5P6Xж0aVĜDSk˶K4_ %5_QZ㎻]F_Q"[39Cx9lNsE{P*W8GWqDMagM7ԙ4M?3_ j^fM*hUmq5xw}}4~Q%s3kWGOn=;w6-7_?~ (rAzTUwoFHBQ_P$R*!DP./^ R'EJFRb+8GR-2)X*)KQ/")J@:)K1OȒbRHQ-EBR̐bӤ*EeRx"d)RJQ"$)(b/8) +Ec-EyRJ#EpI%H)Βbå&P)2"`)I1PR}ȐH"M^RRH,Ew)Rt"I v)J(E)lR$HYx):I'E1RDK%EV)""ERH,Y )LR0HJH! RH?IO)~)R|'ŷR)JK_H7)>R|&>)"ŧR)>#)>)ޗ=)ޕ)ޖ-)ޔ )^5)^)H/I/HIHOIg) )vKIHIK6)vJ;.6)|RJ)>)J"ŽRI{[S;]ۤU-R"R$ōR Rl:))*) ).bIQ R\*%R4KqI^uRB{<y#Gc!=B{<y#Gc!=B{<)G!?B<y#G!?B<y#G!?B<y#G!?B<y#Gc!O;Bv<y#iGӎ!O;"g&ڔ }]Gqfuϩ|]8u._0jNbZɴ_(r_bleLSKعؗ gZĴ,`c4ilZ_\P f1U2U0dsjTr2&LnRILLEL&0gT4g+0ƂF3l<\olnY-WaUL**f2NOMcʝ.e|#nd20Mb*Ÿ@E}1442\ 85i4;}1k@y\_̹_L(bb]ũ2paHmj eE Ez@}A7i/2ԟKEjfSޛΔz1`=RR}(ugrrn398+KddcJ`N3@|֙8Xh(` g0qP.`&3SK*$1ˮHDpD蟁C ??;}Akw|>9π}_O Z߱ ~RgӒbx5KU`_%/@?eY\39-OI վǁǀG k?PR. mG6|@+=~ }[CW[B ~v6Թ%t蛡onG͈u|WWWW刷)d!B_r}lPʹ_ 2绛4uviY]-BWV^e]QU-+v/o9je-nCcLFF(rEFPѨ-u74`m۠Pik߽5Z`/v/r׷,r/]͜2]YivWerWfVgfNwhYR.R]YR잘9=q-c-cܣ3y*2g16Pbv7SlI.+6iu Ef,i\qE{#F[_*""=BqEpE~C#,v]-jֿ԰P{ Br]mZ?iKg2c42Ѩ%4d)W_5.T:zM 7IQʅT\4k*`%8X ,`1P, :`>0 f@ P TJ Ӏ@9Px)d %$(&8 c@>9@60 pYH,`0 2!``0} HҀ^@O @w t`@$x1@4DV ,@ L0jU@D>q8  -p8| | + )xxxxxx xxxx xx <<< << <xx <<< << <ڀ`; x nnn7777kk++ˁMeF`p)p \ \kzTX_` /ֿX_` /ֿX { { { { B{{ { { /־Xk_` }/־r+_ndIf3gQDGuimV1|p[Ytz[_lð=/2(RD/E<DƧX~ Ӻ5)MdlKNiKDmujQOiІ$&avbUDZ1]mZkcS̕k^l|59 bWgB̜1? }%E U(fhIX;` 0[B lQf$s-&i>2/%:*t9ҦCj)+/o:۝M3ZFh]-۲%/7ɻbql'vq6Y`&$)[B-P-?6s7{B.(i(!r93eǡ@^I2& /T:vxk ߣk잰gb#!)e|xɊ k/s\#tW4*et8!bO"Mѧ^ԢϷMMHnuuu=.h74&̽bX]P6Ɛr,9nIAQ$p8XMZnӚF{$0wx۝A(y xJ+qqx!^+ :kTָwO6g"P̯{.nbxl;3#29 A2m Mɍ  1Vyeew햁- } F5f0 @U.&9E>!֏(ȕINIւ8N '{G>{g>=33_T^v=xn{'}FoߺZsߩ7=w/_wbWQ$Tiy޴޴<6^/$-a ^WtwB ri"KqF%[#k#k#{#F`-'8Y,@N ' c@N̤t =ʰb.Y0xm;V]D{-В%`!+gIȘłׅ#pKkhSm4sUۚ rܚm߼*ؐUvK]mă5n n,RӝLh˪.N+C糾{/ +2)rTXvYek>OT4o³42x0:Ï`o4Q cqbɟ&ó[} `ۈ75, 5)Q'E4\ ;*T4H5}&':|m}z٪MKշb3yDDZx"HZhb]M nn$_&_y,.#/ W'W5&}JoN t\Pêxuddqz?~@,NHCAB ssh#L)\2;|p2{}N=6sa'3q2NIE"i>r "`fqB+ i|!˧)5t:BX!FI~.KܟTTfy!qR<F)/Ƣ l)475D+}m-z0x^3q,88k8ߋ!hdu ȅ8˗ܯ;k' MV@t [s2sqw%\xn;7|7|.D{J\?h*uTBhĉ.Mjzz(c'jr!J7`F筭%j+NXϡ7F Pm%k:,-qV#*u+cq\5U3pj'38}h甞q#[Lnc\VrmR]'F*p^78^Ry Eݤq^Tl_L+ȋ+g/ 5r]+[)ƺ={}ۛ.U;x:pغB ܘI<VNFޣR Y%]DD$ .1ʏPQ:ad4 gօ7A$i>a4Ol&/fv}m0Ls:9J]NZw,.]EK]QEdx[ߊ,KP%s^'go{_&$sཋ"ߢXA ,L?OHUӛ?)kFC1+6m}5; DjţB8!H!Z[ FEk7dGR8-?tox o_o/imIM; JWrl}d{ŌJ'?ar1F;¾=nAPc1l=mYC b*BuEAq\)6(ȕacqTL 51y7(=!ؼ&%{l>Z 1עO_.3 XPb0t 'jp/*x^w@hKD{ M? (]?@lH`sZE+d=M-^UJ$uw/+D Β,qyRUH HA$)оpQj{c"}G/S#~e=}COp[d8@uf+UaV1uUN 0dEC“YŊPܘl 9KlKkl2oŬbx52D^*PfvUdQ1zm6 'r 6_s-`{.bYV䁋)}ŵKuďv_˷F,|>jSt6Li*(|ZS"+ah_&Bd Ŷ&eo7{†e'psZaZ@mtZGw,_ztJ`6\vhd.Euxk_8g1 aJL-0*v.L`JrϝL~;e@ous_GԏpĖCC>rCsÐ],x*ӧzp[ʸ; z<(-1"B5QTTeB^W7qԑ\\6]h3,JZǑ,U ͰUS}B/b,EKbQtVy0|sA*6 mV?(,ՀfA;KDzM:-d0CI?tYD`Di: wĠ}'o-jmŕsֿ6W`קrM~C_n7!ݑV?zĖd>eRF5a5D:}-3ʽlM }NBBns6`6s7(]YVs@$%r:|f59ִm/X bw_[:B>5jßk[ #R+f'>Wg{;̂ _Mmo-Q[)[ *o}c$tƹp]N炿*TiӪdyW" 7wp]=@4hR ѣIW+&mEԝv.it[W".6oHbS(RMUϖl'ڳ~|}oE݆Z^Ũ[tPٻ~J<ҷ{p42\9\ U$w,6 <Ȝ.9pE۪#eڀ}y&EO@=TC=B~1+oBՋBmz]=&el! ހ&]۔3H+_E< --t^hl!Lsaʱũ/NI]$ҼzWnz| `@drcO{gva÷3 q-S]~#|@{c(Ǭt2zV3H2j5eQ\(H%To9Y^@ JQKPDHaB`hJz&`*i)-mұm5rZ k, VTW,RS*hC',iN`*jYaF ؘ4hi o27>˅7Ξz!GXځ(7^g$L*>od?JJEGвT ,%_"!o#-/h@q Ƭv)Vp\!Vg p: ͩ%e2$x2RdB28vޛvU-+kY%G趺-^g&;<׬nnXYv}'Գ=;[]QMim.{WmikUg Q_(vaX+vջ} G K0vp);{p2j@[ uZ >JDc&Q 9@dq''~a1 )(i[%)b2DI(WbAtƣ+{z"Jlri$ר,dʶ;Vn4mKwGtkrPn*Q)˔W ~&[#c-a^d%_!D+ޘS⍀ߔ66u=i6 ,GjX K[qiy9 FJͲNaRb\ LJbOG_܃3c :J&3wN{FJeت::m0Њ"x4,4GYGWczzεyM*JnVaB7oA.5:CqVj:R0`:+hX b0~8'ՌkIDphIB& CŤHtL1M2t}RuGr< Q=gEOΊ3, ҳ],/$E@m$g8 >ŷ>i`1y Q=ɮ9Z=[8xtSz; ManpHw5Og-8G:M$݊XCa!Gp>醙*t++L\WQ>639d%$JA ?UxE]:JO& ] ߼e=I=AD|{Gv3m߿/:Rj0t}0-اQbK C6\yʚ埧φԹ^{8Wf DO'I27:uN-k9QnBYo4x gSOd33q w85lJR5:8YREĥ؄AHwi+Ds"9q鵚t(,4 ˥5"m$'K"+d.qiu_XhKdG)UK[fGՇ;Q>mMLŢ,2d) N 0RUP?ei9(x|KTu$F;̀S ש؂߲pNMp8A"7K]vwB8vCU#819 wmFz;slU& —Ғ!T|,b.AF"9 R d !U re ra%-K1GJ({5>dڥb7eRgӟ82 {fdm` F'm5Jg#rwLeˎg2V{2՜q=9Eaj}%pdx '9QQDk"%XqF2{5}JT WִUC# cc'OⱵ>ƣ)FLyBk27Ter-\^ѐ gmϼlllsg Ze(2AʜOz@/?c9Z-Pܢzu$O,+bU;bQ?@ ;,A rv7F#ΐM.~pE UtTJQ zq̕6FoD89?ɉ. Q>n_ʗҩs@́Igq8bx}Ģ' 1_j4Y2E ii,_R% #0c5aQxL{\7 %?L=)d;B /:WWw]G}nݗeuˇԺm6dClB-!&$\!%ل̐IG $:!|!HHog _of',HƲTU_M^$O3`b97nӦ/`ٝ:M  UQlc OXUWV AVvKr%YA+gCNDOTW=X, E{iI@!ۮB۫dʞB,+E;!yuxh څpj-x2jC%܊CCLzq2i4V(2OQgVdm Cz䡆/P2zgQzl:xIdNSRL*-/Vk5y骗 *V, =̟]N~&sdDҬk;K\' %XToehX,w 6-uSjLk]ͫZfr53r :zK\Rס.jQ2u񶚃C@iv90Գs"kpOw%|pR.rc!d}p_@@Kd/0}X!}F^yN-K,[gٚ4|C+ʨ|W vsh93|Cz~$ j˟r5o"%|J#/+'}RcqG]QսVPmZJFJ;n{Z?9!>٩lGan6I@K5ꏴ},9,W*{r;Z9]H:n75ysΒ<\}U얖ha{{kZ;^3~ V@pbu3yR$~샆yj(܃=u F#1<nh(< 9dT ~~i`hx2](eFW 17KW[Ӌ;OܷUzMV=E,2 d]5PnNJVI9$mdⴸVۛ쉘|'95]w3'׶a(U~#Z; vܟ  rp vL ;(^6ˌDk_8@N+1bo)g|RvU5iw"ۭ5ѢF-}f+^CTF&G؈ Z,<>-V-q,E9GxJ4 (|m1 _,5htΔԻ 输n^.ԂC) KaciZ՛F5PwTX@so*U 72Y; j&֑3Y/{u!R$* )x b$[@K [_>UЂB>E|ġ-Oq"DDEE rKdlx$=5 $o} iwAhۡaU޵:`^ (FayN+UAڈ:}qU8qo2 $Z֥,UV<ƺI:Ж]) (M]l.Pxmߟ%𙑔32\EjR!)uaJ Ϩ&b4}b=E@܍V&3*"$~ѓO$e3bzӁ.Lז+_|CI|O(^kVhoOMe %Je&k<'zwk7=_ǮrTН7Yܷ.jtm 7<:|ǵ=㚞;^CYYN^5^5y ><ljBN܎e3:3:|en儎g f]rl|c 't ݲ{ o9$Õ*צY-?OzYlY/ǰ{N~!i0QhhS M#6iۦ! Ǐڢ괟>n?*#jh9W Fn>]>ZO|2>fߪs~6o]N,T! .&{¦jb)?@R5<&œ15FfL kkڄL,H pAHd m)âO.JRNJ-d\bdHވ^ =^C0i P*>85;᝝&JxL>a2 $Un̍G'G?1(PwZBLh(Ȳ!.`^.ժ^!"[h! E$.#R,``{yqtoL *(o VP+J8 )(a_ve_)%BL)0OqUFy*j% QS|m掉FUSZ†- ԑH7iQPY.9KDaj˦Bח ؝ֈtPkDMM=)Nn;Po3b$$~V/{,xm!{MN2?Rv78ԆSSTv*;ؾo m*;![#Z 2`c/UKY G^E%-Ԅ#rI}(̔4L mp%>\rּ9 iYȖL vE6䷬`~dN'wdFUoqf$k]aBB#H2d6|ߙ6+wnusFc@ eES٘2,xeʴ{:57.J!Q׈^>?h: Q@; !u;MDʘY\3DE^V=y_e$3˃K;jޠd57 Ca%tP-[C E6Z?i84欫mA`V5@Rd"K8t9A{ؽa GWh$o >YG}xQ=z#Om鞄ܻ.Q$jz ^փ/CYX ЍB!ݠ Y X 1/{@I z kR% -H&2:DdBM>4)>!Rpg@ Y6$RpMMzx>̧/!UT+,%IKU_ P%fXSgIBR@ӻЛ93ZꪵB^`O.M ?IqJqxV=mP>IO397E]/´j|ޝcdqDq(8w3RC H™9 ) G|Ye#ΖE5X365#EM*MTv}F S&=}RTJ<CX ZEİOa ?ol:s7ηbU3==ZZ tWdIi;UwV1=K͗*54MuŐ_@><ٌ#J.%1 Ww>mFP2ꗨ6y% (p0^'<6[]Hv>8fbJۥ!zNxC3Q7%>;Ըw*ޒxm'J^Ss%\pI|Iwhf x_FƬVWD.:>bNv;=09?aYf`5tо;aNFSE8[XVi NJTZhGY&II,)sb#%5@"o͎W``We*3a&{Xd8K\Kn#}X d=MlfkÑ`!8pG,q+{B,cւp[\hp$ q;<6~8F˱|iN7 $,ТMIPl^87J tʃDFY$!:l&y b!CB'yAݗհZ/fCЉRJXMot8,rYH_$I#]h47F=!@4aoi8dhINy^kå+A)6>bABwlaSD εOԽKW$/J=Dxx*=oga=iRjd"w5Εb%tj NWwdՇB٫{7*ר8TWןT"ҿrk<%?8ɂJ ҄] NizM{:[rWp8]X.{WC0&cB`(tz$ǹϗL}o'D apU<8@}r"ԝ0p;bj :EXXy gp/?+Б2,FOV4#nܺK, .WwkM TL۝avxbpStu6:aElj-kg2CknlJN uh 4`KKl|Dߔ/ sqWR-%uh%G[ʌFj?9ESz!RwVe"K1:&:Tp>k~ðJ$oH>Eݔ^q&h,"#M'h' ‰~#A2$]C} ^3%Ip ',Tu^x/`?h(9-pd9K?)8pZ+DKE:R58+i AqVg+,CR,sĐqF48&OK̘MXDžE}6pJ[$h7 pMY 78-E> 6gl70{VmlQX(aZ,&KMMmKcVuh89ԇD\ >% . \ybV]"3r =E{uJZ@j%b#1鷺Mz~!'l㩧 bEoY?*3pDM^!T-_H?^σXσ "xfmiQory.G͔mE- zLPk:`Po"YpL!MSb4a<,ΧHTC[`9 U{,pTWszn]VjZqV9ڦ`{q7,i{ m6t=&ڕNvuö/$/@!1IDq,uK+Y&ZH}Fчղ ilNz[FΙs$ԓYdXhL3NApfd˗qza:Or ldYAJ~.Tebv0r:}\iXqK,YKYtD17pհyIxL޸Cq7ygu*'^#܄sy!'9EyӶ*Ժ2!>`qZd;G؅g3!w|@:lɿP[ɩp:>ENBy fD.n`8}m.Bȹey>H l&.N3=tS@hS A̻x:68.!NjYϓGs1t1 4kN _&H.Qte vO^GoEs:B5Wp`@/~/Z Ra0 iƭlK#j;R 2t"r W̲/JQ?|d4N?ùf#?8ˮZK}6X6gL4ml΀f2`1G &؊wm_j'_`LS7zdh-Iēx-AP%WpT2Mr S[fre Xᴞ\۽H@YI6GN:sjѤlPLP팅ñhݗ.]+CD cDX\Jՠ$(_ȣ?>yB5lmup׻w`4,"9L(*vD2>S*W?+/4R,/!{:aXPf5ƬES3 8ݪu]к4w5D1=;)2윙Icyd=äs?gIF~"xNaoYbeK&zBYJKK'\I4((zxS\%*<[c#cô0;-մ&8kRPv٠AӟW?UǿeA>酓ã3={תB>~f""3s8}WuK:[ݣhF3!=ܧ=g!|wU:9'|T~?8o p|~n">";\ibsqTn'GZAH k)I3p6$%~xCxJ"*U \"!!6ջ5^^qtoosG Y44φjj <&E۝mm}IZw(HU7|>9pYÓ}?~m캂t< J/.PG({K3^s*ӻk]!wF#$,Zݝ0>^;4tJh)K8(; /2Yacvwqe0HYQoah$9LJ4i ] JT$]еzϜBRl"(j\n6A22%"7AgL=LLivX1&&Dqh+3BF|6.fE48oP{c6Vҁ[R׽nt6ԩrWu;4ohM d2xse*;HD6KUіL+p[:q!)') ÊN xP)+# P~2gЩDSEe(8̞ Цŝ(eqǜ`q9AM_ΰAA5Zs={zy^wI\ d;ݍ7=<]5L7karPĚA.Lo{*2~>ޥ]D@dzgVe;ZU Ε^sOk ߔ3xĩFD¼|H 9#.srnxcۺ8}^GdUq2 _‘Z/4u`3|@MF[cꎍƪǪioydu}\V\4kX͊?uuU֤N݁r; `~wDwXr Ø2Ci.*f1W4jE$mENMwɱHL2in hɠ#1*j|qMRtE23 rlU]59SSh׫ɧO=&@>K9E>D>ԫ'||mVh<.rcgˆj;_Rg+|oNG˦_>I;~EZcZ), )A)'8ļ^Ygrv92/E<7PKg*%ih.L#G (:+''9%B .\'hm۰UK(KK/" RX3Clx)w&(8ʄHMKwQ86 lXcJ)V|v|M5 St`GHnd(:]1eMoukxݔEXNX})&'[bݾ1ʕk 2Q9WΙ"s\.ytLK7G&v1QĦm}eZCipt]:O{}R#߆3\6VZ)[vAD/6:Zn9}NOUOa<⬦qHf:M[!iQ&$ ]p7Fx,8yHL /AgK·ODžp/4DAwLq^gP…w>\Nwȩ5% ha68j?مih{0 ]g7#σr"()9g`f’d0{ rUɥ\i8p"^_f!L)Ud7nl켮χѨE =94t M,ZY9]'8,Κ -UQj)dx6A#HFEDPG-s/ZrX 슂((FA4A *MumLAkA lUV`CZ"1* hYuaV`@`x}|Z~WB aq/^uW^Հ׏nn2ۯytKF[,G&@+}(e^ћX)sWK=DH46ReJ/MWDžh. tIWzM+oҙe7ijVԿ+4sk9:NJd\dx,kot\gHAFŬ~nz)"hJqet@ߑ&y'<4Z3$ )P2{fƛ5dRL\#e-dolbwSh@% T9U"g-?]@q6}%Hlx[I16︿7[f$xPdv֌Ŝӝ`D$%rej :aDVy4 1=| i3=E_˶ȇq1{>cbޤ-A knj]r:d2;&{tc:i,m컡+"heV-vGmiƍ[CRX_RS8E^ΎrΤYs)_Qf)#VX3 VAFD7/ňEKQ\/&wI4t;=q:rq"^]erh}VlJqFO jL;t̏n΢JJɿ(Z3iÔBǗv|nXUl YN@VBV`7娭،_c=GT NT 7kn3KQ%"ps8yA1 Av)Z=Hߤ6`M*rB F:6ڱ,w<+,(ɳAayCLy]sW-.gMM-|xhC9<@.:j&YH$ڂ$uc!``8AkRK p.,kY$ (Ҡt'$؊ø8vDoNDN(шP>}405]$CIF}paݎ'\zc-[JZ6vñbR+ܘrK>;!%R#;-.^oPC͵S(Si ^jZY:qɒ׳#\d˴LfT@la5L%%U`+JEjcZ E'e#ӐTsy!=J* 1>M'1_:OTX6#t¦vt%+x\AR1NVPQe̷͓w/b̷I*NZ&ŘK 1zgpU#X}th@W檑ՁAc5J+-Sӛ75kkCi|iu[Nl_PHVQ!bEQ0&҂՜WPiHYn$d'wPX@qR텗t(^~_2k]ZFW\^vnظ&G_wzwIp=nҷŝձuV7y}Czv|?&^S5 &)UJ[V,SϪ1MjTrIJJ0Q e\lj`VR+3JTXb-'UEgBhxKUKR´iJR5m,lƚ7$#zT|}8hj<,H-:^.e&lVН{&eO[ٍ3a3еU{j;ry ki袵"-k&QWER Z?E|7");ztUo]]hJQuliHMij[ :^^=]=xY e}Ҩ SzsUV#OVuZۛjgcR%Ij>Hh&Q IKsYHʘ2(gwH dM~8o[mpNkz=~g=$$褚&ꝶ4<y?wf[^6Ek N_'|NL3˜N~i׺ 2*?ӉtIKWfa=lSytp* +XpNWlmÛ.efJo3VfکJh.!I7A:mHz=Ra-=#?wک칄GG7&%u4拟Xt4 )8zC*EB) 8Pbk˲ _ _yjbEP,<l@J=O梅%*A\b%,^y027&W#(+&% ~|8V\umP 7cEGV9e^ E KK/P2KIf jg^d >x}FXꙪ495Ty9y_>wOx@vd"e%tp+x x-95,::w5# U>%F: eXTg wU7Њe|yruN% :~L0jMM1ucN:QM`EPE||4G٘J^VĐoCnHƦjid8 <ƎZ]4b׈#I[OS#my qxzү`2hּF +]І"V@I}U@[@҇ddbKbݩ>6Wd"F/#g?6AWM@ Ӎ2<do&@ @:>3xa>KKu\k- q{albBshسO(X ϓIHT.ޖHByWGkv@ׅ1_"%h#+;r|{'gL>$ V/T2#$Cn%hș^I'l`1ud*0f&J9YaJ-bdgê9X~H~GcЯi/.*mGYH)"5q ZE ̥9e<9-ag}G/% TP;Kĸ8?"tj**VS ߝ.,FYu2[]uͦW4(MAJ| 8ҞƄ_œ9VA qĸD p)V,o+Q],nL<(RɢHӰ V-oKp h>ܗpJFB# x\+y$z7||wR*!}| ]0SZ78TLqLL _'OR߅) 1e܏K)ŔXj Q[/UY|]t=iC5|ME6ΟpN g&xL*o͟?dӲKKCؤ5:UH $!Ev!%谏ZAO y ["zXaF?=u &߫*zV0NUͿTKqA l}e*56UdHej}E<<%e7UNupuXnwHT&59=Wa05,Fdenz}φuw55LY_ ކoCX1+iɎMO[pС~"v()Ԅ|s}h.RHV7++Wlƒ JYg \E=2SSzޮ֩*Ac+j 4eIʞ#0c.D&iRW7"|Qd=}Wl˰젩BJ[A$D^HZ;lY淨v+5/Rߧ p4)r.$^9^B?}xǵ.zJ$ `{S:E, -"ٔ,D$J޽7/HdŲu #Q؉[鱯;q,=3X}{/]Μ9sfgwβS ϟ,qRNؤ\4]&XyKylJ9ګ=MIJ,ᵌ`c$6CqªeuF<+F}E6_接״xd^ARVaݕ%EQF5&Lc8v3epZNJVNo?0HD)IR}U)|E3sHȻOe]LP3!9;ӹpKڦr&^cd,ި#57nFE+wkNHpʎ鍮[T*7LkZ;GgַW0FTUܚOPz/D .ҾdݩriȪ})C$y^%Dx%{+BjH`hƠ*/|I&W!̾Q%APw.zK?z"hZaU:@V~BZFvYBDy8y1bk\5Pj:]_pHưKTHF4QWkO3NMw5o)YݭZ[6:gu-ZPCc- Yt_u͞Յ6_t H'JW{QK,4z\*%qtEހ)־*{_(ɃW CV >fp)o' :sk%/.%FJ5rړZo&^kQLJ?#Z̈컥}{iԆL tˈtŠA{ȊAPxŠVENY_+g%=쓕cL U݄˶J@"QHLxgOYՊZR*oU8Օaw2`1#b4dJV"F[;ӱ-+I, N ^Z5X2xg;\<Ꞃwv,vvzkDxuE* rQ}D],w.=?W/=D[_a袧!CWL!FpAs\*w*-ָ Ƅ2{i]'bf"LvSGwڑ:$bp鐈Qx+[U6',(N8XmZpbFjw)rOӱbNdU2W[B>GE![K3qzCxm^moZk \a~(Qtܶ^Y2Sn&ž[Jٓ!O("THcG~> }+nuZN6ԳC&ԖEzwii*'C{{˼e* ,3mp9Џ0OizL4a g=ӥMa;F"5宄6N**UW\bAKV+Lf좊Um#7;Y.]- F}q+FTP ܐ/)a"TJ}re0ᷕD@zlSߺB6TݼuUٵ{@;TxsXKϏD\MvYnwl4BC]o[SHJ*T*q&Z+KV؊I[GYЈ'ڋie`8-6(ʃOp|7g+4`Z| R[-FLRV$h**lr V,R[AU@'Z +F[)=EsVD'#i(M^WjJ^C,of,{`ExE o%]Q<ڼ:]d<Ψ[k]4vֵ-Z&lϹnS+JU؍t=ZXW p7FP'1ᚏĞҠUnQ,uNU2\Zi҄Jџ1Z*փ}G #ui+Ic)8rĔ?G* J[GpeqY,IcA ƎPH~%$)C Kn[p:̡2T*HH) N_ hf4zhSd[f0T"L.d8\Tx@xD"?Mҋ/{q 'z>HDx,lU=|}D /%1t] xKtocKxUA_8SNb4R3>h" Z9yuZ";Ffaޡ(e菜znle՘łǂ㲡k,P3Q|.bs,8 b2})ɯVf$FGSCڌw9)m-s@<9MC\[օuޚ9">g+UEdミ_櫙jGS:7] ߛ~~=Ta esU{ʖq^NqOз$NF8wJ͌g Y<)276N8%TnRwNg A5cÝ}Yiͼ2?sL'yUٿd?٘`g=L~H.Q;O 6Ֆt}ǽ1oLm=>VSj6MգuV&Ȕ{"bn}dDG330I>'~CNQn`%UЫܝԔv[nh"ҪRQGmy;kJ[2U*dFIo(LvowOtziˆ'2-Tʱڄ5പx2[i:¨o0JGo,]%^%S e7Rn8 &n&|9qǡRi@Ǵ)8{3%0R-Xr+()felv)F'~_iH%F "-iZϷ&J ]sΏҡ…Ycr˸hl_cj :/ݏ(&~݃MW 4-u7ʺ ~ʬK޹jmgɅ߸ۮ!홴osTܞ9y[ǟ#_3PL>c:Ѱy?IQ'L s(\C%/z cU vp=6F%U/>$>>De p)YF6)kX#+=-S5Y#3{Ncv;k>R%,(nwD1^~<2'FOH^GdWݣѹ)wU |~=85$sWV,K}M:#  )%FjM m($BV%6Mj[6tz5n7WOfUo/o/gɱU4v9S]rdp6։#+8:'_ˋ=V^R}Q):_hBjZȏj#0!Sxd,müta;>׎W9jssF''U7lR%x˹}2%";_AL^.崸A5/3%Bd td}@:F:*sF !)g6ON]I\5X JN.]Kİ/Z =ZFū{~~U|Ir clm25P|"$԰?9kQjK)2Iu,>ȯsWĴTcOmjVgeGV)28ZJfDceToqG sg`}>pLfvcȋl &a v/yCV`>hom]oA[W7 ^˛j}?[SZ>{]U%T0__^ nA<#xDg/_!3)S=5m e=ZlѦ.G8g?֊/4m dߞP-zƟNfi#/גJ5Xc|,hoqd)yEk;<"i'zE.yt#7Bw4\.jLoEд-]R|Pe)(܃@eXerZҭ09J)%dcvHgRnV˙i_+bWsꨐ=iztN+f`1UlިQ"Ak'j bf^wL*V/`z\ЎgS*25?'x>qa噟[i{q?kbvL}za7~WΟXT}U 2Q.rhͯ\HE0SBbn''oEJhpAfZuL.yVX$nZcf%Di‘?D U_.kT*8d)s 8d" ~} J}t:VfFyq#PY-{j֢[z5*d?JqCtx'\8[GJ-*ةӦ~!0tnQk^ߗl=Gnj%5%M]xhĆ2fh\Qk1X +뮞 ܲbKʈn+|urG+׹c} #% U7 +g&{ _:PʌǔO`2w|ŚM;(yN[sʔr`MgS-eJmN j^*uf]oSլ3rh1j&# -I۰:Q9@"{̪UKgDR)5JOzLxAz:޼ݧ԰bl,5W9zC,v/2@{_ =>Wp4# "L?]|ĭ>qm-iョnR-+%F_ؗ6le#X-]]'Ts݋5R)dyk>_W[jtfh# *P&pTь>9HIh+rEk*i1ʮaU5PNj#V5.Mz[q[j@"M "6KL1aX/R9cVyj]ڼƺAVZo/TRUD[0fyY%kkfmğkԓTlmTe:Att[FR,{\V-U>(1e VZ^+F,.bK=EDRa*K_-_>*r;t^P>? V/vk(hmqeo…kQOjgwŌzy\Uh[F$}66S-Th XLDRzXx UD65 ڈ1Vj[*gՊ>U/epyh]ٍ󗣝JadQm+kXk6֠eZLK6ihYg:NW[Ƕ I%J^7*BfȾHeJϢF2B[Yd=|!Z/ZFEhJ,f8x,e,U ~V]}m}H%ٟ X7-Z ;yntwբZ\1:SJj$e TuLkimsO_O.v4TMCˣ-2T>ΐ36!@UaUmgdC,\dA7x#}mD˥%KcZ+^i6/2 \Q%ZA)Q|HOtC|ʻ : 8(a~Q:ylоPjʋ;-<W(5JMDVi.16~ڄt ߳{ۍ c4߳htcC]}Φvqٚŋ2ư\Z㾶ɿ%eڢD?#WS$¥D ;*U' >EaCnHb}#=߱rɪu[El scޣfTH(g6/dzv;0dtPʠS/2" '< <@(;yX+8@Gx x&eG{`+fGNpppp#$r!3\ѳc$3xdX W'W'W~GA ~M`'Aה.'42CP2wcpt$j_8 <#xP<$|j}8D8L8EpCP_ Q1ajkׁz 7/TH,pH%r# ȼJy`Nx J% w!4VAkyxJ{ېu1m3ŸP>-bh /W@= 2 lI{zaÄGȷ}P|l>-|F5^,D '$q B}x3H0|d~ O; ;I@f}l>NOAg!x0'TPmƒ pppp‡'irKBo w!|Px)=FvBo w!|H+0IrsBn>#/T ? g9M0={q܃OQj1J|R(ۛOPoKD!DdBD!DdBD!DdBD!DdBD!DdBDd%0 2vB ^J< ㇠z.  'O4hH?ѐ~!DC 'O4d9fD,US.p9r@n2p-"""""""""""0a0Lr&9 I$a0a0Lr > 5;F_AI+OZ~ V'`?i'zzQ;^[;#«6q6Pc<@ o:rN C:)ЇDƒ gJl[!! C >rH:MCNId>0=U g2<}#|3\j>x&<@ׁ9a dx IZȀ9L8Ep^02탄76FddX1Rc h a dx^感[灝G͞񑃠!g q4&|~A89 zB"&"Ap/9ku-qVe74R"Y+ij8i4)iEdf LfƙI`)C,J@DTt xEwj)YdQbUKRf=˹9_' q{===E{(pSvx]ϐ#t1~ ^yFKe3^I٧g1T6m7X͸q Ōmb>ٟ3wf2V iI +~x1cP.oW˳i ƶl`w%x-[X~;Dz>LOM"kQ$<-r XWZD{m/׳Y;p7f!?f?%FtFvnq(It4J( s3a18 &絭״.tESrO֟}x0: +ih-iLUڴnvvMKm?NXuioZohox ; <+;R @~5ۯ~. 9 ыBRwpE< BNc3yx E lll<[=[;=ǀe|]8 9 <(ʁ Fa*;isrcQ U9O,WӰڬ@ A 4Dty Y_Ł8⺝,tQ;Y +N,;", tQ 1Ț@Xksš@"k %k\v$YHsɂ@X aA ,ɂ@;.% Vj@X i/Vj4hY Qd5 CVzhYMҽd)ZRz%r_gu7f_gfYSDn(pQF!`(Z}L!{EբP_<4W2iW&?zMTFQ]l߰qhd)L[*yy`qmUFNLDeA1o*+~VYO[eMTU֋dl3U6SmV!NwUvS}V٥S۬GrǬ׮:fg|(jI'Y%ϲ,yeHF,FQY%ϲ,yeɳ,KeY,޲3ʒ)óRqJDXDBD_=x:6j"GKFOmv>%7Fhl!)df܏0-[1#5 J)CF9:% ok1%gMQQ5*IS[-` Y$I$f[J[U1O[ZFϫ9TAZ1{Va!O<ꇬ맸e[Zr&WvZ1,YиxGjbkų À|/jy2_%ސۚ<7ߍԱגIv5{ ڜ}"d_&~^?`_٥mE=z99?,8x {"ru<"|fspi#?8Rm#sie[.PA!ׅE>@;{gC&ȟ3AδQθ7ݩ=W<PJ8^n9IF8G)jY0{.BEgHg3ݙ| Y{ȝ'9K-rPNCFB!y!A>?l}mP/#ٷĚC&g[[ܟxnx22Gsn7_6iȳ(b }d+IkGN^֒Y;jٽnwSDs~,*nnr߲ϜE}h>{lg{'VZnVQֵNW}mrG=>`}8y>Q椏ݪn9;`}*<plX%rwqs"m;WtJYuR mYK XOrD:ԗ^)c[c4g LH #Y*HΎQAA[Q1OQ>#rLm/ LSbȷ`.[/6%yuhmzKFFzԩ\3zu&JM;nwXUlj혿M<O7p%gi-sD3ӜQ3רu=Aׯ=Km[x {g hjkR`Hf eY k'D+FN;z3m3 Zͻ!V:kMvFK{lm_VIkZ'ۊz,[>]u#{b=K;+y\HٶXWG9Key!kҫ#Lz -<_.C>$q1y^ u@"ձD<±hY޾Tl%C͡`1ԝ Ps82ñf Nfyy&}lG}f?FX_l&iξpҌKݑp1!âf26LRwП`(aB溦N9E d(dC`(hFd %pkC)8^폄aZo0!G%1{Ȱ9NɁT$d&bX7RM12h(6RfOȟHf"]SX#2~Q!T8)$O4AbH$6h\3Rf8jkh!ckzp/O,JR:TmZ<+if`&z}Qc/p ́8-{ђ _T L[0@\'O@P=;'~" oEd~T W>ؤyqjİh8nTgÊD,K+,ύp<֛R=h*iF$7\a@< qڼ$6ƆPL Up2' @$~1R{wsGP%rZTf1`pHA,"(<2| "qp4mead*H-~Bf2UJ9`4KKYGTY mL_(/ey + apw8E {b-EuOBX4)rF|! _au,ѻjK ySΆy-8h#'#%,f|U {"jK$64M%m#$9xoP(6 V= $= b/L+XX7]Hsٱ'@O)̧KvkvXggFAΆG %8`1uo-/`X<,3ꛪ*Kʠf%bG#@" eB8qp{⃋ /N|q`l~C1r '> Bd+čH/N"٬#T'ƅR/StQ 6KZ߱ϙCʗc;ǎU!k:V1+i7 ęb%0E2@nXw)ثTŔr88J~GT.Uޫ|DYD5JLT~sUTnRF[[ʘUʷ)qeB'e2UjUA=Iۨ.6h5ZD]%F-h[N:5}VMh_PѾަ=~I{Aoڔ7w+~U^N֦~=mu)?yϵfYsw3 ~WNSts9K ~H@ ~~C'^G*jkU9 ,?K ?gO l?ϗϷϿ +  ~N?gBQ_ʏ1Xϩ=}0?_????_gebWʕgY ~>~e*3f>~?wϓwCMɨsʸZQWϥ'~> ~?'?/yM^h/jk/ijSikz??ׁϧKq+\~zt"\fW kNS?YEU*b Jr`| ܂g?Ϣe*cjy4S ~?W( ~>~>~?o]qS?gVNsi?O?ϧϽ[qR~-\s!s ~n?wou.P"*RYgi?]l>~????7Ee)תM[g#?I??o]g~R\mv*<\ڇ/ig||||?~ ~^wBsK9N?+F~;W#eRW(?-J ~?_?g 'D31ʀ~ ~.?}g ~?_?eerZzmMڕZD g;JOLj//^җjS*oz\{E^{U#g/g;+/22)#>k40cjt^S=S4KT,.{[r8"1Ur8k׮/ݻ;o6~ S47U\E>|acڔ/[8mZZ߇6fڰ)}14:sڡ(daJqnwX>>:N9tk|S>zA0ƺq gz1"* {5;JX0z5`k9H .-vahOYOgj'R3l°s4=^oهQGA +(*Қ*K;Tah>b(VHARnpr&J I1R1-5*NkbǎNp!%ZҷMߗ+R6vf(Tvͧh`aԴMKGazde7@VRqt 0i&egfJk'Oh!nvw{wM,p. sq=]6 p:ƦCN͑'7"ǩ+ND:NEq)_CbCw12~?.,fw;wn>aDA"{r$+VR T D. G\#Ȧ GϦ UNCÛױ+8ӱrzJ9lfN *Ԧs4S##W@$i*Ndwsvo;Ntn>ε34Z."Y :-4]8V^Z;<sˁIٍ w?B]sڞNștzK.[>|۷i +. Pu)TT N5ZSt&Ww?BRRJunE^ʔ6')=r|<GPX!.aw|=Wmm"QxKQ]m"s:S3QKŎRUEQuk%I܈mYlfQ0BB+.c /7|N1ט7>!!αxŋg-DZkVPV+Ԥ3G. kD M]a[repm:SV|.g!z;͑-wQSrS!vs{<0L+o ܞ.^ WYhQvQ]zn!RmaeLL:<]ennzW,G|0CvMxtkY<x$5+Suc/߅/}]>Cq;K|3QȍVd3-۽Pt}y]P8T^='SQrq #5ށޣmx}\p~- ێAF~.#ujij.E_ `r$v}C*+ T~I{UV4Po O)6ey!F2Ȉ̖z (<)9p+gmEo~^MY.p:zNwl!|y<;J oZnd9*uC?kOwiw8ףŭ$3ӤgݰqVTzl˖مǮ`%[.9%\v@6.҃Ğ146>mS]2A'N2CIsL5mcr}h8)I ̛n[eP2O柵ׯT- kS,S]&;44ݕ1q-tвPx\3+v5SڙޕճTBì q{5+,L{TC4QT) V>Y77X{ܓ̓xO=32;3.{we>]ƥL=.,k;Ӽ=Ђ2Ø8Ǚ(!=+_^p]8(^5`Օ]]]]C׍%#Į]^UꙌyfvީLQssxɛS.{V--A^CY! -繭u=`ҿ{2G+xײWNUtUttYYgc+^U!Hij˻Anؤ^)?.x5xQkF1пAd n~l혠W`}byMEo$<"abį>0!pw- &\w6[6ʙZ>7Yn2@B@2q=M,lŒ3 Gb3yzXٔ摺ʌIb!3+IQn%`$k$eʵ wz82$BWWoYTTh} >"z)iN7kDB\%Fĭ"Y#"V1V]aU#D4kBqWER|\|I||VRF<(ZsdD ߂&A|l%KV|KP<.Y‰ 8\/n;W*>'߉o͟1sK,sbQY( M|^JL.CNiTH] XsBwyQmo]gMhK2:sO?A?L1 o_Oߋ8?/x|D)FEx+#*\lKDH|T -&k&>,?K`"x-. qV,_G/g 1%8/ #dGRI_e%4'1.!L*3^XǸ6m݌͌iw0~QƟ0Ah?q9ccg0w1^Řb8x;]_bkh Ì21'tO8O2c|e鞄?`%t8Ob\x&c ƺp4r0v2^N"cC23>G,c\xcHtƸrn>(cH,qodx;];M21 ?g|q$g|qqХ3cϸqc%c52X"u5063ǩ}Aƫ㌛002~3H")W!tUd$(;nƟ$;'2q/3 G{<`0Xxd 9qE팗3$5K=q͌[GGbx?ヌd'b[}/28K5ˀg\qJ:fNecqq+6ƛw2x/d.788^2>oxcb|qLet01c{ε^|HcJxqb+c9~UR%5M3K58qqaQMo-R<\g+tſzJ/BUxMRjZSwIuR҄VZڴ.~>5g G߬ߨߩEX *cl\nD-vnƣƄ)/;29pF[:t>|5ϵصUt])6\uvU^^}G'Yzd,<-|~xz Q)"1")cDjİ"2".DdFbd\d|dȤȎ""GGn̈QqQQ:FF J-*#BTf4FEGWNGoV<O;c䕁T`{q#PN$f' jߡd, NrTA3?BYj,u>i1 /PdEgUX{w'P7H ڂdUGF45.ҸRm25V]`8)0RX `;p .-:Y cRM`r 5Әniqiܧ[YX]ϑjƶjQ>wB@kDArl27V 91P~#6H^(7n$f)9Vh=HUkUTsH0C:m 2\m5Ic/#4xwioWnvÁruXdG(UH="h}0hj +3e˟]uT:|χY-l[F>Οؽ:s]}Rz&qb}:=XߙugŀQ#܀5R-!sݟ)e\YVj5HGA:: ҙ m7t-ep$O !F<#l3@OG٘T?*YmH:Ώ(Qgm##ݧi{ei&Ujd(ߨcctv0F3?Fϒ1#M[RZ@nҺ-lv_jA=h:CJӶHi&ҨmSFSsiΩnSwW#kVe@yFL3bbAr|\"p58X`F:$c9V7LǟS8H(ϭ+P^0"$3=H^(/,x)iar oowEj>>ϢdN\+hAr@$t@Arz|$P^,%PE:HkŲ@9=%PT=x!P^ ,$W W yQ@ҁA@y7Pt5 w<r/(d aQoaqj:ŕj<<;O]b+ pv]` F7FpQMpyй>3^e%}HkpERԫHN 5Wt{m"ԧ (*\u aJj]:}xXG:>|: QZLQETɸ$&1a$Sa4[Rfk5{||6ۙX`v6;g.fV3^d6cߩ?t;ik_+_{~7A^|Ob, 8>. |Bc,""I|RDSX\DcI,)r`i,-b0DN,eE,"VĊ"7VJ"V"`VŪ"/"&aȏ(m(mxwD!|O{((](I=E1?Oa_+qq%p(%ST8BŽ5܏xxϋx /7 ^^MxT bC^>O&jjy<<ǂ!5Ȼf 8f+6f@Bo&f)y1/D`~Os (,  caȁE(`1,91!K` ȅOӐ`ȃ3<gYȇs\[@߂"cSl %'5Ev;“ ;A1Ldx S0+v☊P{a/(}Ɓ8Jep ?gp$8GC9cm}ܫ8C6.Ս;R{Co#`xEH"R(*-T 1"2"}e|e0=,#xk3F! W3u&6'yL&:Y>FhXGs~LIa L%L0flCK_|7E,%'_,?JXEc ` f[a *N vn{p2cpNI8sp.ENFW\pnmwp̘Wx=*_!7yޔ'f9-y+ޚoo;#w)|?3!~Ώ?O?y~A"/+*Ư&o;.> &)"D"WE}D4ś#~)ƉbF|+{M,_)~nG~q@8,~7*ƯN7cc5A#8d6~7Gcqq8e6gsyqѸd\6WkuqӸe6w?{FqyYE j|Q֐5e-Y[֑/D+_䫲|M.Ȇ H6MdS$MBOkEv|[vȎ]I'ߗdY.PvOwCʞX>'r$!r&?gr)Gs9Fx9ANd,ȩrBN_y+9_~-oB\$T~/rBJJkZ\' r$7-r&/rU]r#}r<  yH#<&<%O3<' $/+-ȻyOf^29CΔl9GΕW5y]ސ7ևV7#JzZ'VnSv/cgA`{=fj$;͞lO/ {=˞mϱ__7B[{^eku&{flowؿ;]w}>iU}ݾaߴoٷ;];ӾpLu9ǝIs9u9 Esٹ\u9םMs۹up9}>O}C_ "|(_//Ɨ=++{W777ɗ77777[k=dNT]9*jQ|MD}h$^$~MNdPbcX8"qNuRŭS*n8"9QM˴X oYIuw vJuߚ56Zx)uս>-yE=A"e@)wS}FmޣC4ד@^{#-MV h#{[or}ʭ!*ϻ{b{Dv9#cSG}p&Тr=-ůZZbTKNZ8Ш+x:5/FZ#c-.Yxܜwbl`;߉n q3e+FQr#g5uT4{"0'RtcVll7b Q|GעhGqq,Qy>#+p󎺔yy]:ޠ#M)CV:Yj3.NN`tND8NpbNqǜN>'S)<rp ;Emu[Qwޟ.}*o(^{}> c4P1?1sbbs?kI|~qEXV"Y]V Yk O[4kAi6{ʰwY7(˺Pg }~} =x xO1 0Ca889'Vi0YDH)EQ%\Ua;UMvӌfy4oXyǼry033|{F{Ʋ'<=ؓɞggYYǪz6x<Ֆ[찕bi'sid)b6si77WW ksU|u)kkgaP^=tEugr>e3 - }ܧmdOijx {eYY:E 2Ym0X6V=m4c\fn3g>f5fAqY,b54OfqY,e>~e;oll,b;ʎ;N ;0 qSqW!Lqߩ3H&!^@PgsO}ǫ^b<cA%-M U!>F@[DR8z''Q,!XXĩdY[򩻻|-:PP=78RzB6 l8hhl%[:J-l <;V/Aֵէ$ukbk5T^1'PXW̱Ec=^2e>oS8^k5lk5 k[m@u:J9uw;QE(BL']ɟB |Qxq(KkP|i(O~,T ~}oPMZ!K\.x9H𺴦1FCy^#J//eqARz^JHk4Zh-\JǼJI4ZI/WxiIiҴ,NEՔ/R|):S+p뻰uh~R uudԼ5ir֖U~XY}V :EE^p1E*^رը;# S!Va#hGY 7CAk#$Њ"T.[5C7Ao$5KOwX,e˕P,Ge+)_U/j` ul\'vQ~2() '(;eapb},J=w% Uܫ jTmO6N=(zhEZ]l#2ш@}Ce(mDWt:JkYm۵_US=),g=凘CB!C!S!CR!C!Y9C W~(BH凢ʡPN`b !~ g W(+ʳ*GkڳN,2lFYl[Ȗtmbۉ)v]cw{y yQb7% O)lDŦ$V^a3VAasVQY-X%-s [s5{^aVUa;V]a.^V8ᢱ،Q".^EtO /*L*+) wrυ2uyPbT6hũLb%lJRٜM4-[*[*[glêπ|U Ae'VX-*gu^r"Kr r^륁!MɪIO^7HGTWRRytyf2t>GD`,8v8Fkk%Ő$[*XE,p7to>fz (-"iXj䦨Fn/ԘMWc6CL5rV#7obIV5ٚbMY_X׮V[kO:ko"GA^uǺkaݳ26=3{=e?cqb{^f`/W>a)}ξ`_8:!؎tB'bSNS)tJ9O;2NS)w*8gJsNeySթ1#0om07" ICmiyɴsxZSШVqjmW`7|Y%%IyX b&:Eu e3(vwBZyTNTeT~U*vb*v7PIQ O=TQ?!=A3WYMPl(O)(AϴL[c{̲:BP"{xP5~5ajvk{ S ^*۶չR});y("(h{vǂ z]C:XijwA2:QJ4ʓզQ-|~T?a;vwL7=Hm4&g$ Hhr  DDdaLQI2HQ12;a03g8޿\{ѫUΧn)>ڣb>@- 3VAݷy8v]U.qo~Ƒd*Bkueމa~H>k`kS؄P9 ]WŤKю*N!xUӓ;EN<<@!1M昙tsxg3e3R(֔18t&83ѹg3ns7=L*rfQigs?qt5"g c- |#hУB_+}C_W ЗF_>*J;q~CWMT6[1Bo3cc`Wn=HIlF:Tś \ޅgg]gpv{rny* cy;M,'pV8-|`#m=Vp*SNe6Ӫ|pT3Tgi;5`aι\N9S˩pq8r2-˩p4pӈFNc 8I.6[|l\kZN %[:93ck6 v:9ݜnӁ}t4rtb]Yc !ڱڬ7E|,ba~CӟufMzF_OŹZRXmd MB&UL"b[)pھɞ̶v}>"" #"/F>\Jj'uJ5iFҢ]I'>M$O<"yV}ɯ&8GSVJy#ԌԼ}Rǧ>6X;O+V9UZIimL;v:\H6}@[ӟO BQ!c0Gpgx9 G-ֹذb3-(gaٙ+2dyVZVnVӬ^Ycd:VyV,JƼg.cV]\A,3 U @*@*B*R 2! *@@BZ:!@j| @CHM 5 !@ Z@jBj v:!.@ꆐz@B~i!!@F@iBi qi &!)@f@iBiyȵ@ !-"H H+ Bu@r]i 5! 6@ڄ@iBi]i=!z >tHHG CH' t !t9)RB{ '!Hr#B_?!f 79 2Ȁ2@ C ! 28 2Ȑ2P CC0 À !Á 2<2Ȉ2H #C( !c2&228 B L!L21L2 Ȥr;B& drȝ@ !SL25L2 ȴ2t C@rw=@ !3232 Ȭ2l C}@r_@!y!A y0<! < G<B dndy!d>@懐@YB(GCB , !,(, KBR K, !ˀ,,, +BJ + !* kBZ k !뀬. BF l !l)l [BV [l !Oy S!dm@@BvdG d'!d]@v@vBdO d/!d}@@B9@9 !C@@9B9H9 (!c@@9&TcLj![lV9[@QMCTlbشBŦ*6Q鈊 t|w!uCuC2(R]jNѭ4,zG}9>ΐ >ΐ 9?ΐ ?ΐ 5*3^\BΞIUD.;sm=UXl똝@c4X VvnlʚgNW5WY9S TegJ}h۶t`}ۧ&PҠm3'd(8#2ow~#2tȞޱ*&cKcg|ǹzkjeV+MeVj{N{^d*w; ۵Yb9jEl֨4mYRXMsMwVlgάe[4Ǟ,+ЋcTidgK!nNOd;XB#.)RӜ8RḖ6j&g8?8ЙGm||j:nP^&3Om+6Nra$ ;&`늜~'9vyb; i0]Yϱoo <y>.bjk0D!h5}ڇ~(DmOXOrZnzt ϲ@tmVuNL ,hAۚ+|d>2`y,<ƕg+̱]pcwG,ogZ>g{2/ X'8*JoPnI-(PrS5E H ܕ,T>EJp=NJYȾV9W>AFĘ%Z1z=>(J~*dR$ͼs\f|>{i-|zU`1鄧 h ^eT^="JYIED"D/S$=,g4(LEL{E#:-j zZ=cFj71Vq(&;dOAqHGQqLOg xNV!ur 7g |NV>/_/?˿ȿ J~lQI*YTkFUT{u:NYuQ]U7UꥊX5NWjUԯlJVkԓjZ֫ jګ:{LTo;:UCXѥti]F\]^ +*k@75,)lu,!qZZlM-doy {_.h$wP|otJUhzD|*,"*>/ėr$!V9Ty)-!\+*SW|C)ߒow)'yZ*ʨ*[]rT9ʫj!V5T SS]jQs<5_-P1zJmwNWTEuI]֤-mN:E4]GV?2":t}[ "P{پOD2{Zb8;/0IKqAlN{)OinqZ1p܄Mt!1;|] [{Еpeo\W^ĕ}q%ϐWq8]}^+~u 550 tkW⒥f@v8ez,:N]c?HPr4r c(?1 Ƹi%rZ"腵Ͷ8aqnfZfoDstSݎԝWOדzD"_C%+IhPպy HK`lj7##[q:#8bMLLT|z7-/5Acc8ԉΈ }2O:a cܭ$RDC&ɢhA9GuU-war3nA{YO7t)ʠƜ (J0?VYj fRVY YTJ|@S18JQ(+5E}}-uD= DC*'T^4RU{$:NTEt](\U%r; 9K!]~!_*%lmU䱟[K8HeUjE9 d^$S ?/f֣Z_/ks?ϵr*~ _ӯeUuj~Uo7jkZ~+:okQc(D'*fz,_=kz"D%MOmzr'*oz 'dz*'fzXXk6b e]*i+2αP/gYYOBZKqF皌R<.WW(E)U9k$<4XZfE ZWэ= c&؆0r²$Ѳ?~1" 2ci<ǔi [#ڴq=KߣWǼ?ϴ%V/|a{ol&_κ~mu_ϯo ~S5oᷴn[a~;5/on32 s,:K'>[5)ŴNuJ3p,:[Ine[ָurL̫؊UDƬj%A59}Ԙ :9ybϩ54ښQ:QG(oűh*abxr8~H#l9&v.cW't/Q:f ^j1r#=JH/Lhx;lyV)Pְ3J{1ivrf&$Qg8~Lx[^0'sv.zMVm>h}_<`sP2Rf^oy-!]=%9K-jZD-s,V g/FbI;ٗ)[}܆qc1Mȿ M7o[^TñZ/+;NͦI<t zLG_[ĝլu8 Z\ct!ڪ.bA mF2:Pk  %Yͼ!boc*G|Q,Q웇%|:SAQ@uXG~QOާtcq-*R'p ӟW*{所E݉X-WMEGt,4W/Pe'(?+P8Aʶ#k6qS)T6cllMdr+ׅ<<~:jx_{X ~X'-^w,ϳ16<tG؉qQ#HzVi۲ =uO}0ՌPHWn9ᔦGꑔ-̡8H3J՟)]Cn2s4nE[•TuҔV"s*TS%KUKTnt7R]wFA5w_r_+Ijڹo)}~~;vϺ9˹2o*q7纐3dw)?Q-tԾ䢺Hl7P07s+bn[ḙ V svZx&Nv&n75u{K׺=̳mٶlb1m̶'f a7clIYւڐ6 Rs]M)TbZ<{H? !  6&f ۄ,vw;gLKyLoˑU?dw 19iDNوj>]+!e,\X 7*UјX/7:h5F6^ql϶[flEYlnb[t;qs z;Knw-:힦lNe2Q^%uxMBݼA *5[Nݽu:mQOozy{Soޟ/,̍ཉcq3&(etgk{g'gqC3sM~050Lů\?zo=v6?, 4I:tFAgBg ?-m<F5v=IqvuY3hm<¶/':~: jfOMYvdz;=zW/bFڱ}ܟFlF';O؝cn'=Kf2b+ryy˜Y-֥ɜUgjg`}&&_12$l-qSa;b<į?,:-ԄD ?hӗX R'O };iYb.<n|-F1S{*{_9)wrNpPdO2%yEËP}T_rK|/Q%vr즒xfKOlܜ̭p286:@̏a1Gs),C\9b>BLnX1',8b~Vcb &.,&14,ba1' 1Qa1S$,+D_ u8XJ+s_䇾F(ç 38Rq~KCI/ -Ƒ1^ _z ժq8ruw+핤^GHJ"7ۛU+mkFwuVPKr6[,7eěhG3dV^]cFaH| $ ތZv.ȌB⛧%ZqH=а+ a!c՛].|׾*M|WKv;aXw!$Y.diBѲUzU_~oL4Oxc t|d2 dIB.Z rҐ\<䢕  h5Ek@.ZKT5I=QO'DCѐ4D;TtH3It"E7эEwr)@n$w@R .wd ;̈́td ;=>NAvm,KnIǣ-h "h$EqEڢ$ڢd!#M LeȈ@F\ҙ׀&.g}gCg3g+gkvN 9^2E۫Z\Qy*ADQT\F~E: 5pAڲH_T=[5~Nzܣ({wEz#S?%ߛЎ@O$pw2(ISH1pz*$7KK@t2mZڦ0VA?_WlMB>Q}>DC-mځ:zzO @>1 }b8'FOQ}b _ #1J" *bN,2AvXУCsЇCZ> "xk#xk3xk xkd`nx\sY"e:v?\#Ps`W0Jc1+ Xh"AAa:v> s=%dO21C"l7KˠˡVn-gmAօn-6B[6A[6nqKq<T[J;JhҖ6&7_hގonXv:\ jB-lpuQpuqpr8848,8<88*8888Z Z)Z9ZVprpr{prGpN.;]=ɽ}əhhA{cǁ'? NN~<< bo fiwH=s>襸_+ݻ]qutTj Ռͫ!8QNP5={qi? w0WB;VBkUUʖkV=t;tWP.X;TR5KSrc:>~ kjIT5.ih6[[bbz^?}VYGsW/WW?WHh=8+n`YYVU`ٍ2ʪ6kƺެ/dP6f{D{Mc,6c Bel9[Vl [ֳًl{me/U:{a!}¾egY;.AR5+BezY?\iZey,ԴDmYi$*c!nG3G3I\]I/aLW&Ipp ((uq!>R4`%YIY)VV!cY: AY%V$$UaUHQVU#)AZIeuXRn!i>OJ!)ɚvbX/Ra}H֏#e 6cCR cH:F l C2X6TdRMbȍl Bnbl:N*lf*jq8{=Aj'ٓ[l [BelV{cOI} {4`ϲgIC#s9Ҙm`Hm$Mf4c[ҜmcH m'W+%vnb{Қe{I{}-vm6i;;D`a҉aGHgv%]qvNӤ+}Gb9ҍ}Ͼ'w  =E짨+ѷoiE>ToVVcCyoiWQzdhZK`x+[z ``U`5`u` `M``;>c˟}Ͻ\[\S?ҙ~mt,@Glfѕt }^Gwѽz7@z׻EkYVBZt&euHBʴ?bąRk`mvZCQ+:er+8#ّ(pTvts4qtutrtsv p sqsLvLsts,r,wvwltls8888qqqIQ8i_ G R2rt``"FMUUՀՁ55uu[ovv x7;'7088888 8888xp,^ SSg>\\\ ....>\\ |,p-pp=9/777_nnn  |*5. 6!ދ?z/y/{zKWޯxO{~=wΛĝ^ RoS gޓϽo{=}{#GMGcXQ$2;$"&FJ}9LKr&=|cq'lπ'O<|x}ax׹#B.i3g94zGGGG x/^; 8u-/!7Gî]ۃ+3#>~88Z{PCf( EHi4w͘n^DdSxxq{qY @/җfHZ؜PY$u Z&b2k[v.;ʎclgiYvNdek/]v]hWo,;K{~,¾nif[mv;haw;-$` OSv}eװkkPv# >}sEC8ϣTrBOUiZ>#gZN ĈSk]s% <7h漟2,| K~ȏ1³O?u|=?_|#7o/|_.?? %oAs?ħ4>?3c|&g9|. Rx|'B$_,/rk/W !ZVZ!%d5ne^~{+ҖA(dֽd,.d YR K=MC]~yM{XyO/r('d"K2,'tYAfȊQ$oeYUVe YS/ /WZl'CvZNU%ɻewCA&2ԐdmYG֕zl Fl"fl!o-m|HNir|D>*gL9KΖs\Kk'˾̔9Pr&r%G1'Aѻ+<.R~Rׁ>\(5>ArJh]ڢ+n:=h(Ƣh*梅UVb$!bxH1Jc=bW'x1ALEqh+ډbxPLa1MtEqQݢ!z^#~B="3cZ+Ks\' P<5F~KRL,+JX%3bxVx^ 6h!Il/-b&^S"^]u[!7^'%k"8 Fx_#CqT|$q3qR|.N/ė+Fj $qV9Z I\GqI\?\$wn#ߔ{?[r/-ߖ]yP'a<"?GGXlגy^~ۄ;{{T9Ժ+(Z +58ѲARS"*oͯ /δS4R[VwF;f-xmr, u2heZ[[yG'@1tJgt)]ZmfGG1H5\|>\3M~&]QLy9i:~pv+p<&4燬_U8T &N2qKJm1tZuKymg/-iQ@0ivtVkٓ>OCCSs00W69 69 F`09 9׺}nŷj&宽GOM|.w)wP,p~9?NvdsS>7=nz9qs0&1H5\G 9$:o3BuqLs47=nzD(AP=&>;- +e9f zmd~zZzjE1܇r*U2tK WVD.Mx9ppqXX\Y\ 8KhJhJhJhJ*WBK~\7DLDDS;I=LBG(v]^f6q.e$ 5n&|IxDZ|Yy]p p%bzO(88c?pA_AI```Zd[*A*,L Kg_Ky7"p' YD~ Oٍ8}9$ς&9\wR$0Ley@ϐm,_]3xOy#װh2& %>#N,vEVe`M`=``K r 8`pay=cn` &`4>q`Fg:5݀}CcS[az U{6&7uH2V:5ԊMI;ҞtP;Ԫ3BT+nҝPyGyş;[4=, OQzZ' HC&mVgHs5CUHkݓMs?>=wuN?WL\>o 5njHT?YvJzf%RJ$eԨQN9$MI+Rvʡ 17 Ew4UIjUYm0kZkmYg+tgkk++*1nƨ1b3%f^̪b+ǹgv_u&Ɩ-vlؕcws%ƕk-nH܄qk)wg5a$;L$L(}؄] '=ўtO(BN~1iO7ΛMvfy{wz{yO{sL!ٗktmKW 8 ?7HjZf;<'t^] >Y|=c4q"Yڢ*qbN_S<@UZމtdH#_Y9!w5]`mK--#_y#;,y 򸤪sT a磈Uwq8|wD!LNu;8^vh_m-Ў̣Z_ khk VjlӒn//SL,%dFu's6Cz~m! jM3 aC-5􈡦| qico#ɛKd-d>rUs=2h"MM&m@[`c5 mfh'C:i3t ei Cφ(7ƍ&>7-+PS?бN5tvC6CTDhh9Ck&Ռh q̌B.jyʃfjPfZU/>j)C#M,dߢZy)WW 54e4Dga}6q$3R"̷/,1r&I.u8ɴ$Mܞv :S{rzSf!zyk98+`%[%tUjL!]$wI'QOZd$I 5O8r&b)/%1tM9ɻ 5O"ٔl)j)j)j)jSQ3`$CZp@m7ߢcSHbIlhCj'Ō|)RLM1夼eC}h13K3ԔW]#moSw8>Xt;avyu(#q=1TH5ކ.!>MK7\I3fxi"ۡDB\gXjZCM%ފ| Mzb&:Va_Rwk1Goy\a)Vʙ$*•͌["f7*"s`ʚ<y8YZIv.MUiIJ6irk"7A.BRPD40\ʽĻ"eADh""M4 BH-=iɡkd眽;C 7̐yѐpmDC{71wDGG6jӌS"֨sչiFܼE7Raq29G[kDDΈ^=΃[㺶O%?e\kDBBݲUytq.jo^GϏ6m]ƾa-flm贿 oyM;^5X0N$Ɗix A2N\vc.V*/;$шF6$w$c W8I $clwwnus} :Mih1c[c bz^y=ץL5ܚjS\cjS?3FL-^>j\׻.@r3eZ7:2sc e1NӌLVd2-i}ѠřMK㦜1=M˞iZ_i}i}eU1[3ܦoG7/M7{4m.iZth'ah4oz̎,oZQִ~_L}fLF?rh}Fhb/_kk1YY11MLoҴ]1M.h}Sb5}~->=iCOSoR.7إ61ԘzU1c]bbbԇGog3ccc111Y1ccsbscb b cc911u3M705Q!כjGEa¸'L;g,qɴq4ǛI3fLZyw9f>\\g'vXEkQҧ-SJ()ڿU0J7 (ll-Iɛ?n(Zi!.[[d5Zo(hIpқ_UʖhĔV;[m([J˕mRtkT^/.[ _(R5QFɸldڴjKaC>Z#mfڛi۴{ڎ˕hiK+3JŢzgj\92Ć2()gwKqMkFu͟uEzM׽+W(K=J_ ܫU)Qzgy(ruW)sN|qӞ 4hCzY7t^0|:<U鵪a 5_)c?8t]iUѧ Ӟ3.S23v73gl>erceC2fϟGOL%~|^N/+pl|8+n|JVvѬ )/N綎GL\6>Ӽy˛W6O7Qg͟7'oOx/.ضapã-p7M^"Ž߶ŧZR!g΂7rv/.-^ẔͲ\6se{,|˷/?ӵ?6Qj8h^8:55y&zghnjJfzM{MY=(m^a *Jh?Av}fvUݥoץ+5*{jrNۨ;nCoEߋҰcJUJ+ }g~/K:QT?Ҩhyu+Gߕ%yPkFJS^X^[I;(nNMo_t4E?YigaUv ]NrN1Z:>7\׶筜ʴo.(g~6YVϴn)Z-x?Ȏ&9)x-xz ;s~gi:9&|x[XV0w|rJ\o i9#YB#D^&dLgF9 ! ] f2(Zȁ!b9 ܴ_Zx')xH9D H$YbiL;.p=#,4a s*#j[\< ކâ{P>(#P Qެ< *43~X$:&18E&OgpN&k=dlJL=JI Ɛm#xz 2Y>g[.#n$o^+ZNga&ψiz⩣3/̊OGbt6}Ҫ}o ,,r-̥>҇^z˵=uҗӇ">An{Ӈ~s' 7ǴQ8[fgKF榷-e[ʙgu1c[kzu@z^c7z?0 In0f%VW[*b <kqxixeDa /)1(p/NAj_cׂ aOܯ<~a,R*&&}Uk8C\q}^zx6+o>wx<ǣxcKD>>>>>>>>>O^م s9[Ȝ-dΞ`ΪY92gU~œ 0gs6o1}?yzyZj!Z9b hGю;;;;;;;;;;;;әb`.2T\!s9`KgKgKgKg_Kgۺ0Wo!_H *_ _  yk.kкs1z~|NƉ?qVaNROt Oc>'WQAôoG9~K nnd!Of+-g{ùELOOr#zIOt?s1ϰH4]!:a`>,;} SHO8qJvװ=|>ȇ<_,p5˳3tk_ dI|w Ʌx|KCNgmfYf@4+ă  $H+9-ZqۈF6m=toc6oct \]S_y~#}A0Fmp;s3< `6,JX!wx]&KlQ5|ʲkBKK trPDŽ:&1 uLc uLcBSs4h 5 iЎ3Ut \]Z[vw=\\7@_F& 00#f (na4  Ȅ%O&DI{2 S`*Urxܰ8<o: "ek&m lv@6xvk X˿]5o[ C*2IUz C`ª}(////////////n(G >Ɋs;|_y삯a7p4k!f THv3Ty7ʠU$srYXygZP!LluT|C HuiCR$_j*B77]_]65 ,6 A3B< HdC HJ$ZCh =tic6ict \ [OzuЛ:' |7oc{my"q6́0R%6TbSM%6TbSM%6TbSM%6TbSM%6TbSM%6TbSM%6TbSM%6՞!O82aTp>hq%g}֧BTgx*^ë}xF&jdF&jdF&jd5D 'j8QÉNp5D 'j8QÉNp5D 'j8QÉNp5D 'j8QÉNO._ DBpHCmЦR /nM7(bEq1"Q8Gs%ߍYju qS:75!͈7u+Y3V2d_+a\x7`-6YvF;khgm6YvE;뢝uκhg].Y yǮ2sfÒ0!ofj!Wf^ۋw{n/%*7QMTnrD&*7QMTnrD&*7QMTnrD&*7QMTnrD&*7x>o"sQĨw ; zZSkL< s@X͋uɼD6!/旵ߴmy $D؜CF,5g^+li,7oIgg;[;[pt!:Lf `6<s0`>,a!,Űr`),?3ғ2H,Y3oz"ۼlmQ.ղ F6ux^3n- `H;8 h- ZB+h m-B +Ѱ +Ѱ +Ѱ +d}0 0 F-0 nv c`&qx\09{ y0ðbX9Ds @ \Z#kȓ: \@=hv'̎0*GP9f Äa0av0GP?ԏ~#AGP?ԏ~#AGP?ԏ~#AGPQQQrav0\]..f ˅Q7ԍnu#AFP7ԍnu#AFP7ԍnu#Asn1٭ŕh^#Q$jY1h%yr/ZDeW3!2_!2_Pm~N~ 8 8 8 8\aȇG^<x#/yȋG^<x#/yȋG^<x#/yȋG^<x#/y$ģxtNI<:G'! 3Da(0Cf Q! 3Da(0Cf Q؋^<xc/{؇><}xc؇><}xc؇><}xcp`8xwY+q*q*߁;qO=4=?`9`9`V'_b).⢂ .*ࢂ .p1\ b.p1\ b.p1\ b.p*q*q*q*q*q*q*q*qI%\RpI%\RpJqJqJqJqJqJqJqJqJqJqJqT\Ka\ 1B-.TB5q@{oFjԭFjԭFj nuèF0Q7a nuèF0Q7a nuèF0Q7a N5TN5TN5TN5T Y3DD Q~*v{NuJ :Ր`&x8AuZסuZסuZסuZסuZסuZסuZסuZסuxѺ+Xa!fAY0o~^QQQQQQQQQQQQ *( *(l1B̆!l1B̆!l1B̆!l1B̆!_̆p(C! PB8¡p(C! PB8¡p(C! PB_-RJaQXmh +h +h +h +h +h +hB 1*ĨB 1*ĨB 1*ĨB 1*Ĩص\Xa oĨ"M >ì4G8/ʛ)l2N0Z3EfÊx%| ?IYEfWtY\K(FF*"*jSEU}Ud_WEU}Ud_SAo.K?IhWhٔD3 oP_w9)mWe]D 5AtG|tG|tG|tG|tG|tG|tG|tG|tG|tG|tG|tG|t'*ȩ r *ȩ r@ =At{݃D =At{݃D =At{݃kq.Űr`),A]㟌-͟68q"/o69|,rZ_drpql ]̀ey7 |u[Oq-r`>LU99 Ay6H|Wbr!8 GG8UsP''I vaR-$qOb\Iڤg幤UxGV C|T@ T=PU9T=GP35Y5(Y5*(XGP ,Fb,AKP+PQKP+PU^ꩨ\(R*J(UR5(UR5(UR5(UR5(UR5(uP*PJE)Tr'#?VT|L>@-2oݓ͵ȳ=m,9lYZtKG1r\Hw#Q6ru0rfRremq/DT&}.5|+O<~z2z<\\vJ6_Hևi[Pe!-huVҢ%-NJ[>;2OGqF[\If[&d~Z$ 9ES{<=Of2L&Z]{QkmlkwmZmuC^"^*"jow20 4n @3SgYu󿽗}=p;u,%h%KtW],UsX˓;xOÕAVc01ı8.lNhOǬ'ҿ]>hNZYuVbke ,Xb KLa)_+ka=jVZX&dDs0\}/BXŸj*ܚ8.BMSVf*Asj7ҟ}>D}Vv>;}Ϯa=k6oĨN1S4.s2.f{n3mK)t-bK'[:8bEXYdpm._lE_k7eŷvx/s=ǷaL&4c5ք[\)[j}ތ1pm6t;0^΋y;;bԒ^b_X\d28 >gR$FPdc&[Vm2oxy{L| ?O|,&&>x>.+K_/f!'.I\aaPC]kmɼd2/kmѠS<kcix@;ӝ?H} cf9D^6}3=sse>,&~Wka(1FSSJȀdë55s\2}^ !9py(?DXhRPoO%Tckuv EsEsEsEɢչ5ӵ3øڟ “hQQz)%lٗ yvrN;;ծll. .11o1Fe:O3yī2ֲy1^V+dWŬ-29pѶ^ dL#Kj3%bћFo֊7k|x3bvNΉ'o`X0({E#{-P2,`d{s |b>e>e>%-{­-W+-2lB_ao>%-79|nOrI߶)9O3L~9/|m-_[˷VZ˯7zS[+L?RxB{;dEѼY4oj ֳj=x^^ò,˾76 qh(7nQ *~^dYD:>\4]%EFADl`u׉ "` 6 ,NkD-/D(D:,/VVDT SAtD:iT RhTQyGdiY;VeFY#Z4"C,24[z+UoE5"@Rv~zo;o:n/`*vy]l77QE]}F}.+Y?Q׭$fue]kkn][\k:ךε#zk1ZLz$˧i|{xy/˧5l5Z٪WfV}j٧}j٧7ͻ٨jg.xns57< ;a;|sMtp̶̬U8nfufVgt;n#aDmFfDmFhvMѴMQkٶ(=*=z=mbbZ.^o;Vz[=[lgzS^bw}}^׫ֈ;R^.=6e/+Eb}|)<յj0}"qqtzr-4R:+v%;Vk~'5i;XxyfX"BMBG;?36m)Ld;/vm K&_ҨD&dV͏q;;a5Xװvcx2-Ǻphk/8V9_1ufcڼFf\[kql5ưUߝw~7w~7o6k~:9:V OfliW)fJRWr+G3~G P S4G{ew,FEw)zQzXƽƓ[:u } 3CfXbZ3Xk[6*n+Xp ΰu8Îy+Zg~ys\ckqUV`+)rrUq6 3^cJpVobҷ;E MFňla&n2-FXXXXuXu쪝ُᕨ\C):mvaz蓘>en[a;Ͳev[{dvi٭[vݺGfٺXfk=b[]*|<$wrvQmklJlߕ(|,tA:0j4䣤vikOqf-}^|%O =F;+ξ̾4Kh̼̻Jwl24fgf]fef]ч}wJ]\zY϶;^zɶ+v?T+K*u]lzTf;c5> PK1SK1=gLϱNb*~6SFkϨ##:zڨ6zinڨ6ꦍifڌ9J9h(ڨ(m4=qv=W*O\OQvg/̰ Xg]uBJmJy}V{kêXAj-R-,bT H kF kF kF KD +B +BKty6cͱ)բ5O#UNUjʲ聍h.dy4Gy6hX(I|?:&]ďqmx4FLMh ӢuX{/Yvb/; '| p:>3)O3,1/q. 5\cX4Jk[x;,.{x/,N>J>P| \}Ί´ *ʮ+pWEg`[+uĈ@j$~aLx4u=5%ԧ┊'}|X>''t|pI;S1-ZXt[x4ݎu9, $Q(JJ T#C1aqY?v|P_ˢaItD` `qN)*poB|w]\܇xM0#p=n07ͳyl<;۰$y+nSp'ݸ>܏G( C+Òf_Ǎp /,IF288vH:Ldzp9`Dx% F%A5şD? a<1||8LJ||x4V H~>#Qn-5~V܆#YqVt׊ζl+:ۊΎzxw`U'X VuUP`X^6aւ999-QU:Vw ` `Cq0Jc4Jc<18GںWb01,* 3k3`B&cd워}o2Mv܁)曹^܇1t<xywx3q#&&LVmaWw]mYmYmYmYmYmXmXmXmƘ=%߯ T剥vJhTT׋fY,+eEhbQV4˖A?  @(P @(P @DD(vJh)vJh)vJh%%%=0 O0#S Wcazzzzzh:T4*MCEӌhM3iF4͈4#fDӌhwfyYmwfy9*~1Oi**o,o,o,o,o,o,Ƣ(zh=*ڨ݄6c3:1b:=LgDY",}>VT+NJciOiOiOiOiO˾ *ķm<r2QN&D9('dLr2QN&D9('dLr2QN&D9('dLr2QN-QXXXXXUKԪ%jjڲD:,(#ee,-?:~0Q6@6. W`V>2tllesdj)kÜz_5ozA eDboB;oyFGYY.+ee,岲\VrYY.+ee,%NISt;%NISt;%NISt;%ݞ4<1a#a9TUwժjeь,E3hFȢY4#fdь,E3hΌ̘Ό̘Ό̘Ό̘Ό̘Ό̘Ό;CGrу؃^=!3W9y/˫꿼/˫ *]PV JR(WWUS1CeP<8 HDY>(( * geʢ(pk9?b*@ SA0BȪ< *ʣ(< *ppppUJM)q4u-FcLFM &&"gDȥ."Ӡ|LRo9ևZ*#|;Dq(ő8rjZpZxZxS/Rצώ2jZuA. V4S) VFQ+ py>#|?p5FiڡYbCLd("VCzү TOF='bDTP :T]SBc)"V[jXm-bEL!FQH(Qu^ b=4jJ5͢fQKcQ,ji,Qy~^Wy~^Wy~^Wy~^Wy+Gu娮ՕrTWQ]9+Gu娮ՕrTWQ]9+Gu*O7Oⳡ,|_?r~ď]1 N()?aQS>?!_E(\Uj2o̷\..|BGf,JoϿ-QR|Y/Ke),ŗ_R|Y/Ke),ŗ_R|Y/Ke),ŗ_R|Y/Ke)GŗwptG\~} esُϕ]kyâ$. _L\x)JXޥ &DĆpWbSx;hWom;ވ ˢ72~S~lX%׋jNUvQ8K/eLbQXX:rR=a'߈*KD1D[+BN}&ʝK<=<".xێ0 dﯔM&4J?M'0|M2Ģ(+K գ2GYB}fԉ5i6&̪aKٿFbTҨD2F5aat ME͸o[܊pBCYyh*K F%A5jp80Pap7WJi?1Ϡ7*02? pOq5F~=cgw` f=~L4<1a9fc0_B8_: 1>P}#&&L$L ͸o[܊p;܉q}S1  2/DIbߞX}\\ ӣpv~. 9V?Xcs~ϱ9V?Xcs~ϱ9V?Xcs~ϱ9V?Xcs~ϱ9V?Xcs~qWdo5kCڡfPNSNSw6;՝3æҿۿ:z;/e鉥Qe vnnnC ס+OSATP3jXb5SfHA)$Cm:C!}J8;h/ں@ hӿ1ӿ1ӿ1ӿ1ӿ1ӿ1ӿ1ӿ1ӿ1AvЫ1Q9Fۓ|~i!7czjtqFcN)i섰){&M55c‡1Q{yK}60,JtF}>:%FtBbIt[_>E_)#霵F'  '6Eje3|S ~liw)- OxN;>ï߮&[vErl^Q[#}`g ſE!'>li4 wPe'ϡ]y{h­V;8( *BBȢxQtpr0ttk!9:p=nXx܈ !j!j!j!j!j!j!!j!!QCviYlHb%uGKƵSfk5р蘲TSF&./ܥ% kGg&FOld&?<+:.Ƒ9j>-K=&o'<:aaA.ϊ[(UK(Ad쉭ѠUt5z*uE܆R{9+[,*a~~yyyyw>/ ǓOSҥ֖h?=1in)趚GNojVwmohm~+SZb:b}v %\PoVqʛכ5W7{:n؋}E*éEO#>uč3s,^dzJk,( +칁=}} //<:!=3}q؊vn#;ټw}y#Ffucbet@yuoaXüO`J,w7וʕ.%'_}1#"V1*2(-*EUju$v;u/ۛ{ڧ:2dc(][K{`'ʴU+}Z ZT;y{iN*کNcXc]=vlq{>G'Xj5imW*JrӜb Z1Չ[=^pt񉾥ب ب͢ ƺiu>gKf=rC2n{v%FUɃ(Q}Ľc $pv<Κd!S#]?]?\׎U(>]O{*5]`b{&! "(ECDPQ,>DDQ (HPvPP)"HwBOΝ=s3{n/kQf}zYH2US װJR f/^+^UEZ,7( +6 \K9<+^+"= 镑^jH>\Mi[Բ8B!wgW2\<J8* x:xj`dIFhcЎT#vhwo+㼪ІT!b wk{]w,Ƕx9%T&kE.Ohqe:| (Aiup%IWVPʙNI|cdƍ ʍCbOF i NyZ+q {P|q({Ч#P- 7Q;Zym@H& SGZPwdܑZ#4:# hU=ܕ+ռ W_x*ᨌ* j,7 laSJ M*3+̅[ht`7fXW1j"טY<Ƹu"G9{=Ò>2wՈ%J>&=Z`K- GW5^])Fz4#+ZHi1q xZr*i>55ֲ6zڳ:6֙E;}lac`cccgST>b߳.N x#V7YC~?5ؙ~k/-YSފb ւ_ͯe-E#];N%.]ywoރ`G|u;e/B6/k|#v6{ٻ|??p#},SD"}#RE*AGQITf EUQ-5D-D'eTq*[!lh բh֊f,^4Fq8mfJf[ĕZM7]²EWq?'KR}#Hb:<"f\ħ<*xX-6b0{ ͽf^3~y;w9|=[{<~k_o$??K|_×u|W||7|Xwd#dϖɲ472MVBV<].2e#y [˫ĩ/Gcz|BCq&Yq)Lj[x9^tDEN]r|K-gED/r\ b1\.K3r\!&1R!ъ/+TU]53U31_5WbuP.QrF]bjڋufQlQVu!8R<Sh4n ͽK^_Ak*:Kpsɻ+;wo3uz^`@`D0 xÃ^`D0 ӼA`D# v}>oH y!RtHz#Ctob\7)^ _nM www w {+|gNp]ތ={wݽ==Y^އ_zk KޞHgEG&OEfDc#Gv/kum}L_o;=2n2Qw=d{Һ~TS2KCe =\?#kz_/ʆz~U6үes=SϖP(//e+I^?BXK Az'쥳$FyQ/* EehZ4M>͈D+Dʑrlo}T>)'GEӢFGףщї OHN(+%KȔ'M8 "N)uդ,:Ae֘uTl@B9hmf.3mg.b&g{ ䷩.Bى" Q2#n9H~=Eq&s:1+V-JX]_Ta Px鿙-fY?Q8fg.IT)OzvQxvPŸ-Kl&Ƒ wk>tb]g;ف^xS͋f,~8ۜb3ss-rgzHk޽ry)VT{*Nي͑ͼR•섾R8q9T]4׀4w@Ft 'әeļZ:o=Io"6oUv{{(aH5'g:tҟ?.yQS?RRu))J@ e{9zK}&}-UR׫vnP7P5E\/bEw"WguxrC-Uw|?zZ=Az[{ΧgzRO uP5ayZeR@A(g\8'(gij(z u6;=s{2[F>UsQ:lFOMMMMMMMMMM  $n1<),B;ܗ,,$YYL/dQEJʬRZz^GezJF*7ߪz;xvꝈһ)C{W}!lm(-jM_ЏJJT6t4SGTJj eXt2@ S!ZRY,S)Z**8t`(/DǢq5!:%ONB/Si$,RECJbGá؅CCh8 ApP_E|:= ?B`A\\|n>p8(v8X``Yif8,%Ramvf]ͺ"ƺ!Q(y9q!dG%#%C%&-| r8p0)!`GS)F{b_þqm3V7\.'Ee8+cgm?[sH8 ԅ8qn¡t薦Z֠Xt u+U9t+--ցI݄fu3oQ :!H8 Ǒ}@:0.P x H8j\O@8qn/pؗPO8 @=Gj< ڋE[3p8g!þLj~@h/-Aܢ^izeuP/ݡ^C=veþ4}q;tF"V(~0  6E@y4(Ns߁5I$9dIE|Ols)"*(h(HÑT H2AReec#5b;*;vrؑ xeCщHvng^;!]BIc3F{Vfwy7Wܲ3\ȝS [[l%fYFzsf=oLKXw`iQyr8.f+ܙ]mԷJӷ}1o+w |^aQ[̭W#gio,Ƿ?סWh)Vroط=W8ݳގ|/x6@RN⬣{33CQ![@3#si9[ēz{Ӽ |'~J6  (o~ljYB20eڳ8=:Sֺ|ܳeؕ1M!<+wDgCv2w!ռ{p܏P3 cRۂ;0,Ako4͋ bWh:9|xы16Yf9>jdORzVe瞞f8v9_ٻ\}+((\i+{y߸8%+ז׽{-qWTcoڻ Y~s,lyke-Vs97{ yČt!2q(/6os|d92֘u grsǞc{a`*Ν'ױX6~"gsab73ަ;кCL#03> 61g*~sqqLٴNȟz"73awa աx.}QК_ܜ'dZJLE8߽OЯf9N7]ͽЎ~F}_{y!fiVº8]y;u?[L; (=F2%)ϖ~BJ9 qkf؉hIuđq˟TT-k{ʉ۠:aw&8q"߸Qi޳:3eGμwnợf+z|Q#%3E1K86>}vө +/ލ~K3'w].,~VD.kٛ.\j z#3o-ǶBtT/["ro[ȕprx\Uyj>lujz*gJ?0g8er_r_9 I-lժ917ÿ*Nɩ/s62sb**UV=JS݌1/Y߁cV#i~ێzR˗o ܪW W#]EYfH}CK7$Yf!K|;]5?::į| _1B'_MZN(~K [kt0X7 ҼY̒?{4f#c [U(Gѫ8%;2qd6;O~,jw$`igsy|ng]^C/VZ.$~bN.hB@[r0㣶/Cuݚsb#^}KB[@jϾsuq8vu|b_0Ků'_ceUb֝$TxҿSY\ 2} /O `{fkuuI9:,@2ܜ҉q;3fS_ŴzpV3iRLl Ŀl0_m c7aLZ_kSM7rv\G(]DSrgY[.ߛW#mtw~bD}syˎayP|lN:;|؍?Yώ}I?yܝ58к7S F49i KGwlDjs_6q?vbYip:tX֎K, Ql0Iӭw:el띎޷1>uy=7 띎NG ż%-]R>?M$>VtZg𙴙ߣ|mN-vi_~E$L929s*2<Ϋ\D4 YyKp^咜WdO.EmYAger,z}c;śam7vnح~_uStvXwXoC{d7FZol[olƦYol>>|-8ݸgqzwzw/'׍'[n= Cu}i5gosG|e0Xė`=_l v-+k} 1ze㇬W6~ze, H UڡSDPP}Q1tztjj"*CuB.'. uCBE5k须B]EpVhjֻzkXomM<`~[xr~(SD>"A-G| @rVQ9\Ӭ@F"uE9 hj*1xT?t0MNCr:&_ | 3 )g}p~(?Bj sп_)3+(_˯?ОO/磅?hBN"j$ (y\\zAnf#n{Ѷ}[=NEhn27D툒%oA٭ +w4_2w͗_bvD %w$J0%%w!JnGܑ(3QDg#U42> 4j Tˉ;!.1qgb.&f+qP"n]W7:R"+BCңX.}%K/b"fЋX^ҋA/bFh@hZ ˥"~"V@/b"fЋA/bҋX2E,^""K/b"fЋX./bҋA/bIz+1^rE E̠\zG/ba?, fX.KaKa]@a?,IaX_X֛X0 ?I20f Ippsp­Dpq p í}.&VO..Rrpp#9LppȞިOB+_&1/< ahx(R%<|932<Ҟ%ééD[䄧PT:|&| 47o($)#i@ύp %9<<8]<NJh ?%۩ ~,$~<8<4Ov@O&A5eK,9OY<<y#)#i)Éd8d8pq\iOnӀ|+Ls|&|]VdGplrlp %{&{&{2g, ȥ\BtTF*!GCNL 9-2 R]l.N_tq2ܦvBqnvSb=d;:N+aZÜIt\H]&d,X&!>9:azt:4>z=47DoKI+ONRGރ..A}'O I~Ҍ$LN#3)>}C >frz>!ZEfҖ̤ih6EgD7G7#V%?93$B3iMNRJN2 Zu d&m9%')>.'i N>j;f҈̤u` ڕ ə?EH[F?~ X= q/ / /16^ҏ`c&mDo7i#,Ob&mˉB/ Œ$4` zlscHk[`Xa`=`XeR4!k&v3Cm`hs}%޵%5Wز2ĥ"z.< 鹰=s.XJ)B9B2@ַCw{wP?A6vjc76ַe)NEʲCorX4FyozoZ>oudoѺZiio̺(g{ /(1|ֳ+_E|')7P>0[N'0ٷ)P"*}ik`nt:hUo5H "x`UUåDz(U@.\#\)R3 )'_Per*5(Ss,/3(gLʛCy <fs.b|1ʕ̳AjVS1R\z|r#(f3VjvP%{% U޳޳BJVz+a2\%%|j ,yw8ҿ-ե`?%Rl48 }KKY[W(gr-r1)WS>Fro)7rN)1*4E:Δ*\m0,ap{ZV% >>aZ?d]b~EdmMf˺%lfgf݉n̋&|̋ӬBZl-\}@31k(6RYYj޲ <>1W#3qVm)o6_xzĴ~=+`=*OǮޝޝ5Gmq}6~E[HwH ~ { ߯T-w`^ ~a&c&_'*^"'~{ȓ=EKh\u1[-A'w4q9N+ҙ_Η 7/z>|s)e|;w==&/ j鏓sa0qeEB//DVL/ź:g1J0:~U_:[q0޴>4mȺ5|C1l`Lik Nq8JZW[3c©KK8~)ꆓji8j,Y]OuA?:)4WsSF$ك$z0b5I"˚S5bMAϒՐӭ_c]^ tZ5l{HX7Z7曭Ql8,[Z۬hvN3q 9gjc݃ʓZE= hq!N툵Z[։:o-V`t+qփZVKjYo=z#&=~bmAVf㴵ЉٴuΦ' :DCVuz -CxϢCTk4!Z<x-EhZT>H+B| e?R%cֈ'07aט,/A[rk(s2RfbX̆dG@m )2=v`G)H)=Po4Eqy _^*V^`ZaEi,,ϥV)NVpuŚ̶.jr5|2!U+Q~5'YS{5u8ٯ>wUf b(+Wjck@D[qEq ߵ,cL`/ 8 io1@ Gr&G(e.Giq6Gpea^unf5CRU>_z%5p^e^z?݄k^Y9J <dhKf4UP7/ 6ehZ FXk%jfD$ZS%0Et__vuł1Ҏ<̴T+V%RP3R;S*Ļ)ՁhJnqX/gbeԠKk"Ɵ">ʨy vISh[F k:)ZW ]JlsJZk}55{Lu1fYkmk0W X*/0 [zCz[ Wݪ@YX O[k~_ s0;.fa f{{k1BiB r [^sYƻ,l͜h=cdb23+ev5R_])s`|5fi]ds1iXSfAmaVU@ߌHRC2ƧCreflc4E\{,a 5qTNJ2 T1OLӌFOߤoCZ#y]f} i:J-g鰨#@Y,}^ߋYH_c1Lkҟ@c1;PBoa%H]G,b0ZQTP WdD;lN-}EFq]YSSm~H/OSg4 ` ='}ze4&}'H"-[2ZG>wMу髵р{(SZ7*T/[Q~@)W=aOF8rT];UvTsI+FaG'ȟTj\U8ԯqewʾyVV9۳J1:F[E[p7Jjʔt>q5uj}f@+Z_/S GghBhC`m6`6Xa6̪ΊSU9'~O|+W 51!qJɮNV$n!!bP[bpԟŕv?{dc1b=ξJhl?&f:3ɧbJD{Ok[^[wFX }}P/}vsߓi9nҎY|f?tB-~AV# ߱w=pwdՓi_k㵩[skĺ/Amtϫf+j]x@;w{y XMj>3=u#dt&*?X~X +6g[.ه H>r?Zw-m!3].E艀y>AG=MB鍬 ^ #*ɶXkZoµ^ȵkzj/W.+P&28g'f]ɎwJxdgĻ$ P{hCe*0؆64r!Z2.WD})۔ަ/c7c7OKͤ8N qg7 ڕHN?%' {DįK-B{ !$@.M,\XF %>H|& OI )mf%&#ﰯ?H?5S';{WjJ_gF7x}ʸGeƚ>p2{ rG{ 1 aUIͳ(cXl&\h1X㸖B]'%&!dħ$BL\SO\T=)lOe{ ۓo2a*w`{!"eqgmS<3Rϴ g_F}_g\C3\^~jnz1/ӥ =WHy׌X´wv4:i=~xHҿ';3[v-G!ݟٮ'Wy E>v=f֋bb C> <>'Tw^Tpw`tw""j+yſDļ< 0{ɽ{_XB=(j}K&+ #< "V&VB#Qx0 {I!Ӏ$_D/"Y/"_bP𦅩WbZZ}_ 4J=9R_!uMEcjm [@*km n8F]E"B|!_D/"⋈}0E.$DĞiDiOƜ>1նg{` 8v4}sL}sBNFN},I}hONQyGbN\]aN@oWt=2 _~<<%;;ϋ~gx'a51.CCWay=").ۓG\B)Oq^^yyȟs,}}W\|_\t1c9qVj\J(9 ytL,3:ΘcӫEWQ>2禓1_[#@1m / < >n#Լyݿw//0'\?޾v1[[sEnxod~(?,RlcO|;]8A~C$q~cqZ~B4i~3Q$Zt(>T|ӎ}U=z*?b}zo `^e8C{oW81籊cVZTǶY`,P; .9JdU_Z=z4w_T2+9\+?`X.}A)Sll,dď8OO.d%K%Z'[hp_ڿ##hw4MI;JE{*Sٞ"ěUlUa [miD[Fm**!VEsQ\r.*!0bs1sQ\T0 íƌ49#lH32"le2;Lbv +s&9GSMEW~BO~:\ 6CCǭ͉#N8|i[{sc+(w]K1>9 =S'G_Ϭ;/Y<+ѶV%r7ykrxU ^PF5oWiu;&5$2P77 Lz.f^c4f&mQQE 4穠)&AH`:MȱJ UL q ʙ1m?9v_>:|^֣йc\X]Ƚ]g*o g->kh#-|~' P?|o_NY|߄'5 &.p>Ld_V?^?ϨwIb#J`='ޱyk94?#?8~.֖ݻkMj/Oء&^{?d!{f5*o"+Ȋ[*6{.=5=] 3BNԒZvKPjw|7J^""W㯊*+zou@"_lhzDكXF^9GvH靈8Nd<pN˵ SDv|^8)1Ce /'Rr7du?ɔB)= IuKuydxnjrj'+HN RϦ N)ϝJZ4rCOsoK< +b#ZUDxavƨ ։8+{$z =141cqsDqt)-*9-DDa bn4MCx5q}C109cX|x\q]1J+/WF" UgZܾ,  =Ru§ g:hXq`Uo$A5} )U u2PІlhW U/{X_ 2ҿ֗ˡ"yNЃGP_ġuJ:ăUH[Cg k:sA(}h/Z}cj,Ce17^9F,gWlqR/R/C_2$5a%/^ְz s  P@^A ̰ |cY3ą8\ks%8*γڃ%Bm?:1'@kkjқfLb͙Lׂ֚v(0Vh.bEjs$sf7,Ǻ,-Y\d˅3$5Sіj!B Һ|EOtĄD߫.ҙXÎ׿m#`Xѐ~=ſm6X὆`@+Xt^ya0aFV:9>mM^ EiK+&qٸ,B|gI|+GtE4J=W}@tC~~zGv6W&ނ>Lz>&0:#ٌu~'iiiFfga?vEj sKj]D:X5(&{!h&Y8}rj[\7aY@ Y8s= xϺf|#eImO%hnH 1 q:]}/7S>?J](IQy{$UPSKMM8CoNmL2IOO$3[IV[?"9o#_ש'H>qhǭOU_|iR(1֗ӆO 5|`(! ^#,΋p8/"6j"6CH8/DAN>q~`4 ~D\m=z޴ĴDKKNK&~hաF[l A[m/hlB0~Ulk+dqq'y nb4vVq.+Zjz3S)l7h$_35%_ǙϚ _>oZt 1_2֐S.=7=<﹧M}oQ_]rZ濃R_6 ?5#X+sh.?< Qi/Ο$6L\4?ҥCEP_p]Q\RIğ; !mAY蚦|X^)6ԣ646{ФJ?Ԁ_F ZS^)tR햋PzӸ^i; kA!k>kp-q-Rl4/?c `,1F5qe.u㗍RƢ.@} |^^ɆDuuyc Q)Tev_Yv.Læa3GܸvO"ӿ\k%-oWZxc9y,&[kVUd{5zN^j5|~ ?#o_wU:G=DZLLy{Y-gx8s`INFQ"䯖oi9\2Džuo_.q|4 MqAaq}e;ك|\o/ЁN-2¿i8>莄t1݊Dܕ݃C9]:p6ŘIiL>Io]#3P#ԥt4<ߠAو+%>|f!w=]I!x-|ߣGgff?O<0{cYav.69;E[>Y )g?9ov̎=Ny8 _<ߏ"{X|3whcq3Umq,g;o@1S^=iv Ic'# ϶6j u:BMEj;ջc 2n {i^TϡcP(c%#Cy@yĢާPٲqe%fYr=,}lO.{.p? ˑcl\qǞ[u]Y.Mq9Ώegly2_IkG߈Mg5y<:hq x;S-yݿ>ZtBB?X"8CK,Ǘl܌k7{vwVүP+1DQN)g 8\yB$)O2|ʬrOr2EK)jV>Rc*Ӝrhp,$LA0OIG !ݖJY''A1 r:frA.YsٍQ(*-NvS~r86*;1:{By GJ'D IR%uIL/*F,4B l,侕Ev$ _Q]M CߧD;'H1@X*, KI!iYjI@s]R^i4!F1t^$]K73밥vk!zf|se+5@в֥̕;{s妴܋>Z.E'$.;nq_8 *'!.QGQ3yx;ɜ7y8s[3NJS2RWʒr|6 mFxH%JeH (9$C HaiyGתox"#v$Q9 n1  ﵧ58)Py-=¯fe \ۊl%r xlA5ٶضڶ[q7cDbl5{۴/[qI99Ee2ezHpG/Lݷ-ޖdR}ʶ$"5׎LIB&j$CCz. K~#|$A/ˇLm,RbiA\zJ BKmBB S iHy BA 7!a^>^>g)akG&Q>r#Ov$F=?~1 VeΛmW7.3NH B% BA(G9R#ȏo8!˷l 8Dʽaђ0o̷gcM.~ϋѣ?c),a8Hyq>_F^/W(;;?8^6Owp8-,dQyC;h;͸ȝc\E2b wIW;}n'|<~]'znAsu?Hy2ʆӼxw˔;G^f7q5u3- C}5iWO#%mmtqE\ W\iWZyu흧s "%5N1`vɥ!Rc~~!<ȹ`6>e΋2[b;ɯVvc m 2c0[wuu(@]':M$bz' dJ*lx߲(/f׈@ ك@G6c:䓶ºHŞC?K7{QR4]H=o( t'(O~iѓ--{,>A#G-OZN\lxr ^ur2m%xkUo5[39uRcCȺ P kbfmBp7ZZYGGc3!|zzzz x&If L:3aO7b1 42m;.pH:fc s^e&I)eD6Cƻ" 6pC3s\q|s8sҰ0MfƵ#wr݀{!!np@zywm.C^  g|>_Ho@, /:PeWP_>ҁJ<WU$Y!NHR!d 4\$ҳ'̤;12m9lmŶR&T чd bnikH Fl1y%+붛mwml3NLL #kѳYb/c6X6"#/:=k[m G/<,Oij+ū8)Nh̬'NHi" )[ʓ 4D*8IRDjH[Nipg>+HHGK'OK/Jפ-t_/'-BlmLΔsuzX.-|X]>9$o7-Mn%w^y? ! #<% u& |W~ (:%AIV J*_s(aD3Y@:oQv` vl`^E|rOSD@:wOPU-B,QUNUQj q nܮܭU0ީ#>WOsEz z z_ΡNۉ=ޞdͪǞi!ՁhR.(v!!޾bf鍆n^8h?8ddx~~~>c8t5ϑHHwdG# 868Ct8!w;hv:;.G aZ/01 -88 x1x18x8[7W$VT+2*+* *aIE9 W!W8+<HEăGV8Im*VAk7*nU_1NBAg3ɩgfg&DG"gss=\ kNTSu¨Grniunv8)v.Ngǜ{i:;5۝C as92qQZ:;/^q^yyy9SV&T&*5\E\ene~e!hBw1LLeY%S)RSvRMR Tf{@eke[ʎʮʞ}*WWxtէ0k7؂[w~h6'~&q/coy3`&Ejzr4,UOc2=Gxqy|,}=7kil[,ROglQK=ݞ|gs>m 3994z.Yi\\qs·=w=< :o7k'yӽY\oл[eu{nj6om::*<6Mz;]>oz;===j{&ehw;h9Tk_Ϩ2l/W=vWJ|ԖqrO9(b_Fa%V:~;};}!~FY_H-Nʡ]]4rwwݩ1w7mSx_739ub)Bw}DustDqΪq[(j1m ]n^e¿?Bk,?)XZ? y i-{W`0EHy^ N"#OnW @rF@z K{)rBml+`ܧQ>^t 4Sc5c7@WFj0 {`,"^$\ut&yHa`VII1ddՔԔr5mY53YTf+gwS[gj9Zsds5ە5kܰܲ 5wjLI0>Lu`ijE`H-mRS=+ "< Gc><|&&jkjskk k7ԖiMelh>EXuk^^m@mݤc}mSZ,omQQUS?@ASڒj̵kk~U{bΟ|Sԯn՞]쯽Rx-MQpJ5γeN{kgCq=*Pb(%dlt(#-Cy8T* rj` "ЖVj然vv qԳA kC$A0|:axip-t.t|^CCB7[wIz(BH]|]Rˆ:s]_SWaוjke l*NԹ|!tװnSfͯkV.ex۫u !iX7R7 #ucug˄zu]sn[@. #] ɶ!t9Βpn8_&8\fvw#@+p1n )wz#EǎpOx_"'Oxjx"<i>]^ax>>>XQ]W_P_}s}I}7jzQVփWGo뷫;w@ohmh 6hhjipppñ3<ˍ,cpaQ7vȽ!$!,*"Q"nZb*U-"E% TD@j-RJ%y|^@lg~sf;s̙'I/U?(b[ocUZzxxy+lX'/_/}|L|'J>3n'^|u|]|Sxe|_P* KꔜTҸII3ߒ%-.SU%=/,d`7v%%Y2 GK&dJf-y䭒%+J x*6d}ђ%[䛒oK|0D YD5։]v$:$:'$z%E=F'w'Kdq|~2?Cڼ.aȾ㒣>|2919)9=9#9;9?(Э4LvɝJ^$JISRf]S'?RѓҰNICw^XMK!->n'+܊J;V8;W)*7/X:4.c/VS)ޯ>|]c M`BumڦSLCu29SlZs)fy=q-讲[Tv,XdG"3'3WdeV2R22U2WeVeVfWlk*_PDu TmUSI>V Z}kOt]W)Z,Bg<]遺Dg~XDC?B@Ճ9=߮cz_g4E?ןzRzcM?'{=z@?藂Aa3!<;<[ ߅N&:b[k060[MNx{8֜>>i.'epjùᇦ_XV_SsO-fƄ_ߘ_opy8Vk"'EN1""g##y+##mӑ:g"W#s#"ox"oFyّ"˼&?Ey##^#3{{O8"ߙ)T3o"JB7 =h5- Ost.?zUw8OljجؼؒWt[cnlUQXElClkl[lG;7޿޿S!k5Fy)?KTyYeK%̫U3G3ϼfM {};S֚*|d>cA2fUΚ/*|efΝ:ӞV <: P5xuTcP5,4/[Zӽ6^[uR9^g:û»R5WYGuIGoWc~t*'gGS?Xˣrj( ;%ɨʩ#=2'o=߱ON^V[93kkԞOWyEVnOJmYRn)[R? !oUsu TkDPsGlڪj)!Sωj)uـEinS).ujϩdYoUNSt}?Xz>giL}r޳[m3nRj-٧>窯sR{m6>^ײk=3SgRu}\TW[OBu2OurꦯCTw=TUu\U=*W#TTߢoQ1}8o=êG~\ u'k]o z^z*?kTjDFˌꖌ2S#3dUh^ݖ19=ʌ+>ꎌ!׫2nȸAcǶ^l";z*f4צ7lz+ ֨A3s澑Vkrn<+~>GM4#m͊DG[GF;D;GD{EEѡDG>egS/EgEEFDGWE+[nVEZ:j5kˎ5ko+bb}+o FFgLl\CX04HڥkI<>'bXX{!kOڳ&X/)~& k? koا%6 o͟͟_ͷaZ7"k_]w;uk9:G]w/گ~R_SWaWc]y7kR=^S?bv;տտB=f}o7U_=k/k ]gf⌁ՀdFR~/u=Oϛ>]a mPI)^c̦Nw7ms;~ mG'9zx46yDfɑDnN9--r(wr%Gditdt4In%Nrb*YZt4rJrkO';0z.mtdZZS=§WґI"cC:HGHB=A~*5ф-FI6 86)Ǧ6)}s{|J͛zl?#Ɏ.oV$筒`y~Vڑ[꼅}Itj߷$ﯰIn>rw$u侙姒r/}l}XsW-n?翥rOv;Rf?H-/8ۏ)_qwJ ?֏cȘt$76s~Lėǭ?s?+*μLY7`i{Ο#M{l,8KW_&wr.UOne {v|ػܸsw.ס_gхܶ2%sr~-;:eM:]'SYYz7ϖ#w -~%;F2%הZ@_]mGqFގc/벬yҷ~ׯڮ9$u`.^Z,kpz-~\CR_`|P]R~<ͯ>GL_W>_}*ohG~_LcRȈo:(“ 6)l&IboiExgDI//RCl!_H-J:&/UiK`}] ']|"T.-\I) KK,7ٺ1 eʐw Kt\<=߁;30O_o y 6^јzd֨ j ݪ1 v#n) KPׁnd izIG[j,ShL>]XIJzZV*^W zY +FXNJ4SV*-U DcU`%z+^XJ4YV*VBWm5YJtXZ- ]c  n&g; W')8 bG%izZbѴIG8gSy\JA |Su{@c˔K^Z4>PZ֎A9`0͡2x-[/ ~@}>d 0O K3sa=52 <|av@^2 <Ì·f]3Cg<|q 8h 7ή`o^.w;~y@wA=%c=KѤe4KY=5[[,ʣF@c!>>ёψ{ AϞpZ<" w:@-=jLqme0Xz0J$Y[G[c{-Al;|NSb *؆f9[Y#̓Ȝ 2Fǖ|l*L^s f7a%5A<ЕO i詝)y=1EOhgztk=a-3BT-ij"AY ] tՃvUx;@?nmthWBIKC.Ut{m»_"c<6VhvD j Jk^8ȴ[|6 1X坋~.AI-|o3 dzM>"so?hݾ=Vt~xm0N@ދC_"Jm[^6.nW)m m_XH`3fGru-dG -4}m n1e9[AopBς=z!K9e#=tw{.8`oz>+co> ݥ zu}sqʯ=qkׅӋN2~SAӉ y)Uj~bz~;󰠥mL?AKCWZu۶~VkYLu^/jA[_ȿ̿x/l9~9PPUyIOnq} hC5#>4XmkyOP7Nٿex+ꖂԲZS JNi+(m{#A~tђr"zrHyoO ])+A CFP1&GP1AKdŨ]R2A]ۤ/;;IgVjFKvЋ1bH$ERj ]6]2^[sQe;VKϨc "o2.~oɻєM QB#}h_/lF-۟-1-=nFrћQ4m&Ѵ+t8,mot-14;; OP9ȯK'<7R/be i􏆷8 3_,oA?Yɂ]!R",g-%*tL|8RoLN,=Z%b8qhbv.&`[~Atj_# EFfY-:m*NH%AԅN]Α 9áp޶+gx[ۅ6Ø~J{E[y+ǀS gp7^+k"}تo~o:갎 J8pzy;"4뭂6D 0V>Gu~+WuS<5Od|MnvNg84N &u"xjR 5g89}Mr4%<%de{ %o%WRrn >*Xt̾6w``8vh)ٮR{#fRf\̥=ɻ[W˚>E 7#rDy&:igہB;ћ7\dġȇ2C/c273`xk=g 3bz7DfBZ!rZC`ȘwL ܀]6z 渝f5߶eN06sCBh ,M+Bћdp֓=2[@4/%s@eSA^sRF~CKPBC=D{d&bP4wD6|~a91qaE#*vN"'֥?JŇPf"خ(X%Q 5>  g2\C/! YoжU"=7S:3ZC_߲q)QC#yZA]SM5n@ЁJXְI6߈%{[9t;ؿ8$z' %ؗVDb#9#l82_5,hfy2"3au@P@AJ :n41\SRNf'21m߽vo(^X{/##,-%C݆,fD\? u$Qv F!vIQrVpזf*%B?Κ5r?~^Np³e_>!ܦH>dw#y==|-"SZ(w=ОԸy<1:[}y.[Y2'k7Kck-󥃜Zt`4c3g8R)y_~B/ھg睴Rɤ}YKu=BiK)9ѩX9=?h9cN?WU5FF?]NBkwO8Yhpp xR{wIc9118>~zD^/%6:Bo͹l_L9)цVj]D -E$s5|ks)Sd%ZM:# g+E)"~M7%[rEBb&zε˹\p6snuNbyڝyuL{;lB"+/akBQӂj ``5Տ3s9Iiƿlp2tRB'F+䫂zC T,y!33gx9A#Eg2 DF_; 5:'ms Rю\>;ڦp:!߉vr'|5wNh,xQOJ^={RW;8zٝ!ӶGNg'ÙI+. /Nz"zHArX=B~S^+kZJ -!)ʮK/?",,ڼ\ ̸9l)g˶^XЇ«f-oX%M}Np p\s԰>fc5 %F0hVZp^ȼӑlh$sX?s8.Z<_( <$+ GW/a*t UΙX$o? ιp&yTƁL%i#% wYDA19 (8,y'?OfZ;L [W\vG{3bhm(46 "{p~ kxoASs- 0_f׈Ygm N.=-Ϸmeѩ? bm[)ӻfPZuZq7ecɎQEfHNh<&_ĜIo3Sv"Q֕XWc+AGpusV!+2h> GY rx75m9eOMWL_`_Qd̽Tww L7ll3;_S qtQg#Xz>j)M 6f 4%p'&L?YR.244Ef+2M ?=HhZ6J8o7v)w_vm'2"vsݜ菐[9T9*Va 5>ox{=YY&]-|e&RKgE|igJ{fq`ZPowһ i0)ӹe|{YVl¢R0XhZV`T/ M/ӆ^2[v8˩A=\ y>}Ђ?CN˟Ef>2'vZ1sףZɫXY:;rJ\]Z{} "8In1*8x%uKUxkvz|g>R7w'X_;yV OWncӶE3N/8Cq7`X| |:u;Ko_ŏٕ7YkאmMm~'Zٜ7f[:a8]J {ˎBh ߌ&%apsDe&B33RyW"?aljeZIRMO%XJTP'C0%yfP6, W>؞ *ջGF֓|}sf7ҬZ%\p m/_^PN Woqp|{ AY f^esR0ʉ_BOЫD>D99y/ܯX-'{2 saaA!0A92b 1ZBg}k|.k>3Zb\ZKZ.5Zk\Z{΅+bǬ׮ֽ>g>}u̩--l 8^b u5q.qͺLYeS︮RwfOS>!+,oo{"Yw}quy)w䭸.pߦ\oԳU*V,}Bƚ ٬_Y^g_5 !>ż'(WWOB/Ɣ1g5<<\Y!gKIk\x qu3r%DXO]D D|L-Z!Љ男eQ(_uu oCwuPA'nIWo>E?d 4x~Ż_\]ӯ̂*R2% eŖEN-b-#SQo}ÖSo07DJVrm>H 2OP![fm̿)?ϧ?o|ZƧe,}-&+S:6!{N=G=o3L+ecS3?mCtavF>Bg( SB )(=eg,KƲe fÔFmOP>wiunZ]1Z1Ӓݶ%2_&7);靲픇){Y/PwqW'yz^mw>CG:uʯS{1)sns)ϥx~9jc)cLodz#uRO=LSQfYٿ.lc6usdԣS:|u|هgM椟E?/RjV;7ΓzRgbbJjd}8_/r}Ad~{E|ϲ YsUUK-GGL67?y~@ H H+^i?2ǽzV>m|0-oX.}6c13W7WR[bUe/,-uC=$MR%i Rfl{'ssm#Ʋ{%~>xzX.>M$Oڞ}KL%+;}>Nr(G y_Q;Yϲe/a,jV 飞>ʜ2Q9j.ܬۮ'Gwӣm;~~2絇 "eV/g,<ZVͶt3?w^=z{JJ7/7ׯ̓Ž{9רk,+,+?AL͝zz(_|mdݴy@KƕqW}Z}&OJ%NKgB:6O=/>!gz}ȳσ<<ij<\q%U*4}(>>_ij?ͳϛx<|1>뫮Iﹾʳc<O=;Rۮߖm<|)O=_g=ųS緥gX//x~/$Ⱥ)6ʥ*\Ih48O>gX-dy'4~98g*'Kd8l^aZQ9*lcOaށt -YȒK9F}U(z*aO;97rŪ!ka`)qk=j6&,\:jVR`'EȻZa2YknKGaFr#5-*hfy"ݢk8Gz2ʬ~Hu:eY9bqZ-փ0WGqKCI(s2^ͷExY"^m3%u"ΊTHƛxK܊];.E\ [ x/roB3;Xh;K`Z H̼Ptl|Z_)K7A bLnKē=تتsC쮹>5'y8<<PTg+c0ZM'@VZSĎc\o {S{SRMDPj u,ޓJNMO]J]M _MHF{9ޟ1nz?ΐ9Cvɿ[$ZI%)EECd.)^RܜhN,0o>O<4W1;:2ZM։i#m#obTc4O2}@z:sKi`Þ"vE;μHσ_uȇJo}>1ͫIwaf`_cd6F6 yt?>Stgi2xZYO1Ofʫ>2:^r|h{8Fmx=QgQCؖ1`"Ǐaa4; 3vh2Ǘ m`eL2EY(e`?dq/ŻܛMG(u9:X2'0~;Ƒ~3O6㨓*9N>Ks1+H9{_-S=Nݢ>63N<9SS{,T]Wl{#{XcܑO5d7#G}'1̱=v;s~;qsDҌyeDfgsvM-M a69t?&n">{O'04Pg۩X ML/{;cv~m4w3϶p(7hyAimW~7E?̼ܰmGlaI/oPw  ¾ƪתqo8lۃ=Ȱ{?`a_caOctkaOcybaocaocm%dka© 7?+ߨgߔ$)  {~8΀s"9[.xI9 @]^̉+ՠN׃@{6MXvdSm;AMNy}`;!G8ipUp݉od='w/$E1E^b/b0t_DJ/XIqrY^&ٷX hht3BGTMoz\=zYUԛPlͧkZ6W+תj -Қ5CKi˴*mMkyakzG;m39rQ]Ƶ[]H9_ "T/+jVޤަzޥ&O߮C|ޥ!~V?_ү ~oF&u$<9y+P 08MDFX^qaC}IvM^Q$%{ly9WʑK&/O._r1)O.ߔoߒ Qg"o[~Zok{ )]ߐwww_:fuUK%I0 n:ɐCGF>Me- A Z_-̸opbaTZ}U`>lsicssK|MHa3,[^,BybKR'ɾb_U$OiRSwYf_Jo/H}Y*u*z}?#|}WzwwKXKNтҋuZOQ F^.ĩjB|oAfe=$?WG)zNX]^Q-@}y4ViZVUkZPӴ&E6]uhZ֣j>mK۫i1=GyeLv9HɄ.ާr\=Osyz^ =/Z zB_/W*j}Nߠfݡoַ;>~8Otb}P?'# ~/~SN>OGhvO~FKsU#˝_ѪhCT.w9jDSe~OxEt4IFaniXb{sԙ KK1?_ )E̎\_^i+˘#_ _J77H77IEǬ{R5y:ԬVת fu+`[݇pxmOxMvRԆCpAh j:]FYkym |^;}v_=[/<}ܖw}^R1ZUU>J_ȱt,қ#+uCSJwhf}J_w^ߨo76*a]~})ٴHv0Ryz~D֏²H~]`~N]9pOXd>wmTN#aQO4'hтhѓ6-.8 F`^aVGk]4(3ih[|mgѲ5xG;qaNm1hv1_ji^71C?IK---oWu΢}z_?K--o 堨]o尨w2(.@9m *l71o_ c %%Xo%(ܻԊAJI B2k] Y@}Ew;]3G{xS➧TH=ǑH=ϑ}Soߡ{"q9CC'Cd04 n"_{=Pp3 ]Sjh""MoٮI t;-8~g;^F;,i#mA5FsX/Oe ʥ ;\;Q=r-/D[BO.E#0v7}HwCr(;; 峧:|n>m!C?uE /3tIR)A vp.~KK\<kȕ/IhghwcWݹB3fJ<,{.>~69|>2p>P/5$(/EBկfZy7[!;d'{p֠4,jPo64Ұ hXEy (ohF`#Ұ;cO~νDpLƽ Wqp n?j4\i~P 55\l,eՍ *5Vcv:AWc{ƾ퍻^p5!g'oo<.x{By`H楟#5 ``3. .+!,X\ `3 v}0FdupiI0 Fح>+ {{C!vHP JBsAWUl O>E Y7[62چx'CC#S3ρ?t%t-4:(4 Ƴp6ȑK Tpm8Hp e+Ƹt IB]ʽMpw:"G.u2P‡§gYSup\E{ x!ߎF"#`ị̑D ęDgH[ Z)'R$"+#u|xuYđ`Gd7}E`99Y ~fGݐ## 2REnFN'd Y)JRB.WpRnPehhPRL,+*LW6NcˤM٩"#Q 9rNqrOկzEj)2iժx Q亏] "k:b뵪!jj6qNqڋx?y{Mvu tD=:Cig;8w"$uBjZgb<JyŷaY `#/wZ'vB|'Yp|`\p]F1f.#Y녠D ϫzPZڋ}^r ;3o?ԝtUՕ^RA4MB» 1$"E ET)RRRJRRDHT1fDJ1 R "4s.]v͚ߚ5>s}f˸ *z?x[>yXKh,ݺbU8x4D>UX-i2΃gD_. -Z.4 _uЦ[o~[5xU{DG>=p? !bȥB] t*4r-@r !v+3Jy[,mVfDanaBU^6\vew'u?q:./܈r:EwӫOn"{2|_xЋCjkبF?^L Wjݩʎug+]N Er-k} tÅFՏ{|$w]@EBKf/Z%VhC&mj@v]B{zHqBg#^)? uKu**zsj467\-Ar?LhD tn 6L0]hft0ae U ׆q& MnX!z+VG9 6 m<,a\w :PU m8* I r~V5V G%CԶ5k8Zg>eQWVdq< u*ES=+˽QڀrmOUK>"TLm^s:ubZս UBcfV)BӪf#[wWf ?Wh~A@Vߦ=TG3fsDh2-zuYuݹLl|uB;SR+ZYy&MZ) ]E^ O(Z/yVV ֪INIk5V#6}Mn)#Rp_)74=,1TNΤŖT *)ޘh _X518#~ޯ18PIU u1-6Uʔ܏EwBKƁu[QIzhIr?;/.V64 mٰC HG~(F'R+gv6MݣO!db[g LS&rw,.Q|#OB݅JRLjMU W()V۴Zt%F&;,1K\󝗝JjOBSxn-2KBeFʽQC.~%Bm՛$SLl|e M}Z qi>m MRMX+k# y4v]B{ox躟wtDblcx67;4,=>}PƵ҃j6Ӗ&4BaEhRMYI'4QhM\D[޿^ذNOҧ:]/# 3Z]/u#(Yu-z.VZX2/XhYH ՕurX54YHiy9ߌ;n3{A檩BfucU\[jhJk~gZ֜ թ5rݘjk+rYGҲ7釅? Chu=WB*!j&r#5JLZZy~h@Q\"AjpVAށDW?@.D*GgyyH0\ՈPó4Fh[yZ1 ~3sI}\y 'Ij6=#~R,|\?F?;|Q{F%^gF`hbREJqO)oΡkA*g5RWj)|#H֡K?A Fcs=V5gam:Z _O& Yd z\ߡE3(,-ќ|5OߪX -2j ~(d$m|FK JGm;9f!5v(34+zE|8{N$s\QU҄QS,J9lG {HF객po|ExI7t!ߌ-$ׁ[kZƫMRA<ǧEQO>y*3zR#뷚f-9{C6ިjIJ|:r{OPM\glC ;!yԇHyRQV4<hś᠎x?tk{?/Җ?b*h4:s'I3aswciAz KhNJl뮼YTgJY]EVtEޥgيNrW g2);09"V (AV9}~JքO?#4^mVk[OOoCSO!_E¯C>(ȮoOk J.Zgjt/H=Lj?%weՑB=ZgMk%#k΋T.vV+h鋴Tm>G_%ӫ)1FD3]Jxb+NKV%Ԥ}3Bm%^ 31QG0{c4ٕz.}vmOF4E>6.fg5`.Ew-}\cy 5X.2NGR:?g5LTfe)V成yRzר݉x=hy61Dl;Ʒ#]͎v6vWgct6"EgEds6\UF1%f#Xq6Jgp6ꛍfcE݈fc(n6~[Flf#>f#l6ZwF\#>fElL5M8j6EMlFGqѢh6Dl(vF36Ql$3F/ql2'lL(CF{Fl(Ƙ.fc6XEìha "b}(_6"E4/+F$(vQl.ѹl\("rIl-s+E-OFҲ1l(nE!Fl+F1lt+ƲQl**Yeg =`#TT6TwSQ)QL)ʵ ől(5xQ6REn6"e@OQ'8O6SFuqp"zd#6XMQ&3ElL&a(d=F1AW)Ĩ(J6~dc&EђlLAfEE1 m$$G6x:Qcd#E1=F0l"F*1D%l,( C6損6jf# BQT!OȮdوA6V"2 d7h?wJ؝' ~`MY!6K yƖ;cފ:CFO1kKa{px:b3<(IMԊu |>\R BE~ Ig :S` *X _ _#  ޤ֐zߠԣ|o= kC࿏b/ :#ЙMמ)S!|+ᯄ{\[߄ Z<ß?|N!y_P@^;OӊwmE"ިlOQȹOAKʇsV9sNJ3չ-D[栭sW\Ǩs*\Mw.ρ9ȯBseG5H'X9RoB>%΁R'ćsT&Y$v'bn<>KMH`*,\ %|%|\Rx:еksx s$x79}I$3s< p 8CHk>K/AN\#}eg c~dx569#܅ĮG[yfNJO$xkW?"armYm[ om䌯ˉ'{7 ap/;Hu+cO&#i1fǷ5gL=fO߂NJaX|<Ż\ D!Sg鋜@kxJOQ޵}2<\}2kDb(UϽxyJ <| WYEߧ&{2_c9eKзn; g;gԾ]ޤt5G?\s>Vк_EC) cT2RxV*X]F^&=fׁjto9 Ryyvu~\)\ڽ"^!_CQXM]kod?ꐞ Q!3"fJ!VA+gaaf1%v?md,ȾMVUSp g]dsbV[;\}Z1to ݄c/R-&ޣe ~~/_'ϓ;%Xx3r1$Mz.xw@G'H"=U2%g_tz 3AtnЧzsɏ+>| P9 Sn__o=؃,Z- $T؟)#a*x/;w9vWzD͘Q=u\F1-1[Exv3kez2)(3%v&/+9o\x$_ IjW|yR5I X7]ܧ +:?Q\|A=~79gX?G؟63:㜛I*6Wlמyg轺q<\.3^9@j+#)&.x y{cI𻌻 NjRO)*ӖiTiCS$c$oxVֹ=-*{gO]lߌ9'uWe_uc%絤Y=므VMcLlS!㕊-YQԳҹ;7]g'$8 /6$<6]$MnNItN#2|H˽ͬ٩HQP!GH=ա? v)$@v?TZ~t8=^3NѺe 2Oړ;I+Y|Ƈףf\qBIՑ7\$Ol/AπvC9>D%3q (px/Ag+f|( !~po7YxYog#H._ 6#x+dy>lُ#y-K oc"X/|] }܈ӌn9}Uۛ@GW|?][Io\}ທxH:3 57l䳑| hW@mMF9zF:4;-KKNg&רU߂{_{؉g+Ts??)/:a3^!>p3ئo+njp[1 :{^zQy]jLyW;h ^ !ECbuDsEwkOn/i~޶-:^;v_tڒ'cQߝ~ۏ',:N)szgs3ޙv:+w;'vtEnOMCXVɝuKݕ:wqpv/]uJ*7{eO2˛-V{m.ow;OrO?տ۟/+s~?Ob cű 7vulhldl\lRlZlfCeUͱرX[,7j7L ӂ)M f/. W#鳃 fsѤNtk`A(X,V^`k)S=`~&X"+`c9h;D5 MJI-y.0k½ܚl v !y$y<&dpMEjڜ\\\+ R`&J.%u}rn6L$֠U`Nkijn R+y  ;Q y ;|@ؿ<8 ow$8.駅;*p핚_SJCƭX'!\Dp&h.ZpyZpʮEJU ׽'et܄+外T+MX.CۥC08*c6B-oHDn!5dmT5AOl\[,ZnpNߖܑܭAJF'DKnUQĺpEbYZe-kѢڗ7>%\yeUp08bH̎#|!BsR^jXłeR?j5)Jj`\0Q-ݑ JɃr(oD {ԢNAB2JoF&IOѼɳ=eV%O$%_An>. $'ճdsrz]PT'_&('7JR#<8\tH((K.I8\o/ $' w0,O@r{89J}`~rp{$ur3X4 =(I'"ݓ%X.O&]+ z&;$e~eA<|D8c n)\ryYө·L^(3u]Ɉ? 3ӂڠ>ZVa`=DY-M轲BsE{FGLhED#Z'׶i":ѡFN &M uRve˵{t.ר2w,UG7"gmK倨Mm4naNv u?l/Kkݼ}Av_P=y3My/W~a{1sE~A~-$t_kdomJοǔ=)n3L5*u:m&WMm2W忝O 4&r95k'7&n4c7kM&sm+A'n'Lx1ibӉ7'&0#''ͨ|Xт"3،)+37 /ތ-f\ASwen+QU3ྂ9frw ) ֙?zK?~IZ/ҵ̴s_-vYd}+Yk6Li7as̜2gLްp:E? =Pg3Lp&^Ngp8rglcAs9uB]*&VȺV1\tA2B*dQ1:EW5[+T I,^ȏT\'x7VJ_W!Oy-oսTJW~M%+? K=+K;VYfwt᫑D'hZÉ ,DPGQˇW d,ׁ2\eonDtZ>sԷ+s᭦sFJ&f::W6#""]H{u/:d~@1~b 5yܤg'\bd\KK{Z(e"Zڵ|z,[{,*_ Bdcf cb\zȗ+cP_i~=&O1T,+YztEו,=:HqУ;:K_r]QzcfMr? ow{qG-ZNيJHP}LSkF&P f|E"&S$433"OFuo>jZg}{99N* p7ƒe|xBitFZX.,77>O+xxOHi%Tk!V2>!a57 ׮6yeJJ`k0hM'+lH 4d4@0W#Ȍa"hCZ]m4BrGd%833F5$DVAktRU5!:[mGn%T>T/4W/JlP*ViCz6+L6o(Pmd(jQ62lhY!3̐*anMQ0h64C9 4U?Oe*NgO+ڸ\W ʆT&yYIw߆T~yVҝ!`MJ*R_WwCYi%] )+AM]Yb%] )K@;,Ćstk+!ZL>PQ@*Bd%Di/(*v@ڀJP]2T ) @>J]28DVSJ\ i+_׼F)ySSmr+N{]JV+Ǵ)ȭC|+iCmHC:bslHsAj#s9V1Fڇ 4U6Җ7`UўU )ڀƹ/~δuti 8'u}L/e`ҾGxO,V#:^k ,N⡤!)̄~0j@X"a#ށ9`($Ta*X%&Z F ݠϩMk5p&aH ۰E-^%yC;Ͽ*Ek$e%@Jn=$[[#ΰݍSvgc @k,!W  _pL(~yP)=jAra]]\.Zw1$cཊKhsF*o!3MJi*ȵL3AnfZZ!`ܗqw`@yc"̸ɻ_eZ{CVpPfҿ>T'd&5I_&(D!Fjb4$ M:9ZlߡɧfXs>J ^9ӿSDVNp[[22܏{yGy']]` ˃Gyy~~Ls@Y>NGQ ͅJ rF-hFȸfh ~:A(td\Bg$ Sɸ P]& g<>_gȯ{0_;b=Lr:|!8i7ui#i:a 9 `NOڬ&^ga /pm[n84n1:23[$[O끜@k9d]fk0x컓}KL,Dg(]KuHOէ#F^/7m-X"hꙀgsaaz$KW'E3MPR-DK a]/c}H^Bx.-[".RnINTM8 *$h\` Һ,IΡ3yy"4'F\YR)%R$K:$"]$GP) 3ދ u~v,qZM|?j9dS=I(m  Lx=)O= ݀4; \*i$0|f}A 8nDˈ; K?XO(,Erʲ"xoUitOK#]E^rGRȤ>;k @#ٓrzSkSO<,)$K;]ul‰kINrbTh%!1]_֤ŏI؜tN}’D&rXd^JA@m#>טRf,D&eR uE͍2Knz嵚Oągo5-v!']@L珈G9+aYFR= L>&6{Y[5ɽk|b bp|+uk`LdUyZ8GeJ]dzXӠ@Yo YWU#7 ?tL.ŏ:{Aڱ;U^[Veȡ߷g0B/vs>;ޤ+ 'o^XG?6Is|OF^;-jٿ8@8}>i0"Z~CrfZUpeJGG"Tߓ6VEN}e}&:^[u杹ۻf~,2{.Z'g쓐5oY\gVhplݶn|xz=ѧy#* p}6fÿv_0gZՉ3|=N Z:&էf,;s.o9io(rMVy~u5&lz^V";7qܘXS)'"o&A}|;oW\CG1 FLߛ1(\bɟoMzN|JU]>=dbo<7!_;uco [^4}ɩĈ^vv9aӢdV>sn(^ OO.b|OlwU)+f>>b'F2X<.9~]2$[4"":ݳﳾ?S=0dK7×{ aSfخ^q;ѝo2FB gPH$uT࣑]OМa.&&* /aRb.ϿckG相ޢK#%;Atxt7_攟>:8պ[*j\sfh6q՗}?^ah "/ȋ!bF^,迳5fhǮz~v_Eg]OڷO$?zۼk'g6p4kag',}uҾ/wk/v7zýAnlKׯȴ3ܯx|KIbugI^f{΍/ԍ0|@g;'7ճݨ ΦMݶFQy{O->򽋿>{4 ykؾoEWN]+8A=jC;{kUZKI"';)"i/ %_V'mj+rtܰGwHpǻ@ݝǧ?xE{ui%1B~9(_W\f;<ӝgTo پ3|ڐv 1^OC_;[zd3͢3/O'eɎʊxgYycfOF޻4;b]C6$_vIME;+B+ R]ѪʟVvq$={X[OGvIM+'9$ٻcx:;UeW+~OJ}fvJnzVRE+Ƭ^e5rl5bɾ%ә v-3M٢qϗ%|NdxKv5?),W%=g@~fԏ䬝a[v~ySr/oy0'6Hv7O<~cʭוsjt[?mkI'[?^M~EΙk 'j@÷Nbc  y_pJڃE;Pyv^5Hito&͓Ld1L"Ǥ0&&$ h3kGFJJ<&i¬vTtx4+n O] ƤYN^ ?sgW󓻣7K7O>[{55~Oe|4LIlum_mِ#-|bKOmQתt@ 3WlY^s$E<~֙6:ipZn*BvJդKŊ}Ev?pEOBMlë'%aey4工XCog߃8=ם<߫5}Mٓ0̡OWt/lb0hbRAa(PH*}J)MH 'In #r !?hذ01 } z/ީq zk VD6^l1i9yB=_8ɶ=5_adRDK%c© R*eվph9^;[m0}j xwFo;[F|ϧϽ}Idg];qeO.~py,G'FZ^d.obǓCD)hv|{/KMeo>3G>Tflk/Wc;N;q[V(\Qvէx*'yknExH endstream endobj 189 0 obj [ 0[ 507] 3[ 226 579] 18[ 533] 24[ 615] 28[ 488] 38[ 459 631] 47[ 252] 62[ 420] 68[ 855 646] 75[ 662] 87[ 517] 90[ 543] 94[ 459] 100[ 487] 116[ 890] 258[ 479] 271[ 525 423] 282[ 525] 286[ 498] 296[ 305] 336[ 471] 346[ 525] 349[ 230] 364[ 455] 367[ 230] 373[ 799 525] 381[ 527] 393[ 525] 395[ 525 349] 400[ 391] 410[ 335] 437[ 525] 448[ 452 715] 454[ 433 453] 853[ 250 268 268 252] 859[ 250] 876[ 386] 882[ 306] 884[ 498] 894[ 303 303] 923[ 894] 951[ 498] 1004[ 507 507 507 507 507 507 507 507 507] ] endobj 190 0 obj [ 226 0 0 498 0 0 0 0 303 303 0 0 250 306 252 386 507 507 507 507 507 507 507 507 507 0 268 268 0 0 0 0 894 579 0 533 615 488 459 631 0 252 0 0 420 855 646 662 517 0 543 459 487 0 0 890 0 0 0 0 0 0 0 0 0 479 525 423 525 498 305 471 525 230 0 455 230 799 525 527 525 525 349 391 335 525 452 715 433 453] endobj 191 0 obj [ 250] endobj 192 0 obj [ 226 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 507 0 0 0 0 0 0 276 0 0 0 0 0 0 606 0 0 630 488 459 637 0 267 0 0 0 874 659 676 0 0 563 473 495 653 0 0 0 0 0 0 0 0 0 0 0 494 0 418 537 503 316 0 537 246 0 0 246 0 537 538 0 0 355 399 347 537 0 745] endobj 193 0 obj <> stream x \U3s  0D/"*(xE04Ӵi2+jX97L+3-mmwe+]1{ V3sgQ!ɛ*AJ0.-.}X5ؔO>`XIҲ\`a2n15&BZoQ*>jV`s|6&3gT60c^P0ČKY `yf˦\ ݸp>  /eipμ3N0 ߋy|A`3\K 7^2MÓ|?q|ַ̛{x6_8o4dgoYgUؿ3BY+11ܙ=yZE8*}&O%/BY(d/Cd;R.=S&oAOBNBm2#\o"  H@Hśjσ/9g י_o Ԝo? ]t~ H@S0׶!q.,Ke17,s۱}zXg W,.~m$  H@$ ;;gJyϔ|| g$  H@$  H@ׅmo  H@$  H@$ 9~Y]' H@$  H@Ek}.[9L cP NKߛDȅB#ƀ á Za1l,۔n6Lae* d>m l a3۸j#Kj(i ;}; |O0}REsoXyәn׼3-Cca4~o߸##[C2.JS 23Kav [ֲ v1Y%(7RKߜØO,O դ~MS(>GӘun`?G)dmߡȖKi1 ύ7fȯY6mɓ&׹jkU3jTȊe%Ë9< LGFzݖdM7DuZJDAz7evkyy[ච Yz:sNtx2e0 HZ-#%VKX]u%zSJWIi]h15,5XJe46`{jp𙪌thW1Ɣ;: eRBH)-l X/mMu%Ƅzå܊ -gҞ~mm7iMb#VjKViTk;uLwԝf*\6vZMwx'LXޝǗr]cƽn33-4%.^z5OUif{tKF:F_/[ܢafƙm֒[mY gY؀P]δwGX >sj*jnh,-5Py[};bܙ 5'^V4`l9RgLp;1|ֺ|:w1\tE ng> [N0|`)k`,tIY>Ń-unxOi3mx9/yƄ'ܫ-zD9gțw(R:W4*w)X/5tw6s&`3Ϣ↱:Lkאsl45ulWImS Xܝ,K3vO!{gWt[ڂ5mqAV+돷fnֲFEg)kkt/mh.mX+ڬ5uR_-7. JVY[{Oqnw55,kj<7׷'aY> UVn a&X7sJeA` قm ftdul\p bnK-M|z75 p*񗹙u(v&(4nuf[m-"n/"ۃpa({R[)\Pu`dEޤ竭K8bO6ub[{6Fpm@ul3qv7.n%eR @J̸WֻEKYrk!N;) eַYs{om55ud1b/VOA `gXhF-5i/U2D}*DZr+ oI-:/V:{dJUj*w}7SKpg᝖Z bVш?WŚ]9jGKzIF?>~Jo;|U+ڂg@ Q3qublF@&fB"ԣ21Cx14'?>Iދ UD5l !|qBd299EZOi"OqanڒlETkTDx6DU^'Y^z3QԯQb"ú[` ְBc6wyio=t7+}Ip9I>!|L!>𘕈)]) qcA1e"&ExN#«?^!2%‹ԉ#Hy>Gx Ä O6 'I)DŽቲ"N Oxxp5'6-›R2J 5*5vg+؟˄/^ èQB}Qz꽨nCu+ԻTnB Vԍތzꍨ7nP6ǯGuZaJ$x O8/񥵈УKkb|B "<…  <:BB!00GO%xB:&dzJ!h=8)LCPT%!V8'!ډꧨ~ۨo먯 O>zu?cwT܁VRz|_JYBXLJN(8 #8 E!4HB!c(/wFE\FYG=&%!&TF* # rBPBH$$P-x`"XB @Ì&D97#P@=z{PEר_~ꇨ@;.PG#PC}ߣF}u/ݨPwn/tQxxb̈́Y& tB#000000PO#L 'LBAH'R )d`I"X r ;ې>T/GؿzϨ eԗP_@CF_-:b+Wؾҵ|]僖W.ˍ˖o_rŲ˶/uɖF,T/v-پإ^4j[?hUhmmj]zsQ4ۺp; kTuCPnNhU-*_Z}Ka رLZ.hX I)e;oATlnA-1---+Z<"_ѲE؁)٢Ԗ]T><P >j/xcs1` 8fvr4fnorpLw5:\S\SOqMvLtM>UsM@Zk{Q515UJר핮rWrr6Q*;߼|,S7曄c&q~8aƮ]+@11c숑J Q3?le0_R/d2o CDŽN <*v<R8&dZHK. k#2LmvV\eN#̩MJ.+ҌLӈ[4̩} >WO@d01f/g?}ʁ PVW;ָm5Y=ѭXIu]_΄oRuT\6yĭ[Mݙ .p9`5p-bn&np+v،q-2 6Jdp`!(BGвFʽm<vQ;aEqx !-s{p~W_T Ͻ WpW/Wx ހ8GC-׻w=;ѓM#X|0go4Cyg^)|>v`=sO(cw%Gx?'z>/yzzZ=Q᫽f!EG=>@eFؾu).^Ǹ;|TOÞN'|''_ט-1c뙖o;N ]r]gtL`"xON[%19S̔L4LBX(W(QT9KRpe43Xf},%^e1=%,$fEI5czƣGt/T'{LLg, dh| ,Kb1p!$GKwmC [}ۺ{X-{#>ʧ\|7,|3Ig,5ĭ,ޕex B ܱEP{N JJ3< ZȚX+V+ P[Ǒ#,οt꺞dvf!BPBaMty9Cvkb 8T1 bDeL|1biWpi l9KELJf-ZYe++DypPbkU8SA4!CN~)95AVrQA$ťZ WߙbLʎR CѱqAUƮMh*gmٺaD}'eO# ?#A]P6i)Fk5h!D*k dVm4;ՠaaFlJZ*mX Aaqa. EEEa\=v)9,&sÑfSP2+Oƾ}ZYii(d1!(D&2 k(s o8֔а uhdZ'JɺB2Et?l>R-g^ȮUB}…͸cA  VTT W?C2ss8ݿE==,?).VlIYq{,,>+11+>LnL2vgY4 c|[19WM>U]q_; Z.+L Z=J!!faOrrAsTP0*5őF`QPЩ/(H bS=S`dkTTns T֡3[sRbOF 2H:bUS&bcs$%:bT [Q0eAGuMR&]5%{jjƦV*LS4r׹c}c6@9 B83~ lSZc5йMγB*zve̶<:z۷{fݿxX{&]e*@ l1938΁fOj^+)`NgnÐǙP}GJδ{Ni3-FzݑɢCZxEEE ۓCSU0_I#[7οi5&8zGs`SnFJP܌KV%CU=*7sWޚ,&,6vhxHJAgMκ0{1ߥEpb ׽3nݝ1][A2O `N0<&JZ)Q?8^)JӡKoTp6^HoM?tTkG] Ūex R5*/.jz-cF1HVgML4:]=cb ) ӋӲUOY7b0GD[cM)c)b5x~Wu"oN^0dtrX#|ULOc'q֌[>JTtUT͔9ٳ51&s5?Na>=4pQE؀bpSӍy}kڊ>wmUSzmyʥVNx1d+۬a->peɐe=D6{Qs\=F{PY:$A T6D'kzo-j;tNFf,od |4O[Ĭg0M5h`v~Z6;kfdh>ihnX=nm5 BOtcX/Qܤ Wɘ,HggS: ȃ!$ |e11S'3([N`sۃ@Q)҇tfžq^ BNi-k.Jk5I 6 KL9U~&HM2BKּz+WDsLvh1fO|ījcL1Q|fVn.&w{weyBpdgCQgQ}ja-nmNM5\?MBsTم[^rP]ўеeKs'ĸbO I: MWUi8(c;XIoL6*ѷ+O<.Ǝy< c/<]xGBLdὂ(e2eHw? MF-ZE}VFIѪ0aE)^eUߨVmνqjr\ ;hYiikw,BѷgNsxU6#J ޻:|C3ٸb.@JV\E, _L8;:o%VnI,ؖee'6$n& / ;L- !l2{d],!]b}U}Ą7]]Rw}kAcNpm'ȇ:$o\00R|k00HعYI3n.\^Rí7x]5v}lt~yWM9= '7ݶf'6F_zSAܰ/TT~Ohmv] av'pc9ӈ1<Πy[`knUD^l3 ciF; A~'hIE];߮*FOՎkGk#ZiZ5%}~`Kw@&JtU$>J>q?U` {\wh!BRB3aU%Uժjf!,\ŁҼTK)X/U)y4@)9_ߟVII2M3>Mol(N3hmyRw0S;xt4ЛU lqdFQe ϯ&-m-ƿ#ZӑdŦqƖFaQhg:l짴7#qJ2Ec@6U!H]"ҏ㿀v YYi$@fռJ?Q ۂ^iA[!-- j⭿<lJӃCgW %Th~|>x =VĔ"bkbbrB(BG&_8 0: "-ǵVPJ3U^=Cr+-q]$ s/ؐyu'ٽQ1jFBlm?o\5[;*T( ),{[~ey>+n ȭVڐKQD'HyjJ/%$d t]T&г7""-TY>-IoT"Sɼ<ЍRS'N~`@NZJv[2LPSx5)nuݯ֥09 Jܖ}ҁAsp))AD!G\ ~2`IK$"~(2DP;,?w/-#E7U)+`r mf߸ܝtʂF9_8qUB, ~#U=֊|py.u}1-qgZINUl,eN ;W< ){ܦްwwobD=ٯa9\pJږ8-"DQipIhϑ)f5j!ac-ȉGlt)7$d:3#qBmnxw~d?wS%󜢳d bvF/Djݙ:MB'٢z*bz; MD577 zllLƿ!i_\&TBF%]/HLRyR Y{=w hdbӝicОKRRg& Vʍ܉OA#[5o˧4BM(jYy -C܏p {jk"g1MYrUZC' =%#F_{mO#nބ}=Fk~LɗX[KٙCZ- NUN aݫJeR=V4 ~*ځm˕rs@D5y <],z|p{5@Lh<4ӛcx5$}>_(ʶ2[i-x.Aӛj[l.ueA;c7_˕-aH58waYxֵ!rlMhf2x/$Ű-wӽJY='+lws |q IۏdrS:&ӅJoJk9]ezd X1ܚ+rd.-+ x=#fcAˇɇ:ըF2 t0? bR(eN|} ln-GhY)losRKQA;<#D_ǐwwl ;S]lv8|8O=CPo߱AyF+}IUPB|BV<%j=Wk&@82zf5r{'5.(dtM5Ɏs:T2[fA ߸<\Skpqyf%Jzp p+ r; \rm3_>:bD[G|ϟqΌߗv)_ZVKZ0 ג @ODL2$ v Itt"^@G |7-[b_P}*jH(Ԥ-`?*@WʔkL&jZ6?tGܰY&p#9 ݹp(V(ܹP8T`nd~5Wy[WPOu$.p-# " QoP P{w[wYc.oT͖#{j⌌E#tmf$y '<5'1ٖHtg@L|MH;ܟv-7!Vl5 +u%ɦ) 5l|&?hfYXn9?x$2LUa^ejߘA6ad/eJmmdVDXX0$e[IJ.AF4(7k-. Cy6¡ItSZ} QHIFIdm>L.Z`; %IwF%@d$ɵwE |`>w@r x>"KJGvBNjå88ê'Uru{-g!&fQ[J2 <ɵ(pI9u63P3 򗏯^)5 6]fzjs\Zu-1$vW D//_SF al;+<}B!  bo^ӯϟ^ֻDi o^Y{ƨ+ Vid0GH_m ր= Y5 .ˍyE?Zr\ m2,Znm׺uh%\'d-?Pn/ jۦiOL,RԎj #]iw\2 ШAmpԾ_Kq^hLX.=p\ 5yư"!!P ZI*l $Yp.T&HrFzc "vvz bT1a l O)Cֶܑܬ>=֝_R ^wc3o==xh`[hh{}7S{0)q)Ezq?;ػ*ރD>~[\9 朕hܟ`fA#GˈUwktDDӉyԼ?b|5nacͥ%d,D5wVT: Qq)+Pғv5#]((&},jfEa Z7u{aVW*NգMzūs]6wN|<<|e$A[ i_H{.!R{zJg܎TNï$c-{oLJ^ s{7_K {}0XHH2@@@dCO4l*KoCa կ@S;q@|Ȕ8 ;5zQR2m.c fV&u|_NQM7~aG% l\QjmU1˺byKKh :Wfƒ$t}`m7{8!ZZ-o!^X8kjM ޒ]^;!K)؂䥢v`3KiumG_ G-AD VؽbOq6 !쌄<Mhb"] 'ہl='##hǰK#ix7(m*p6r.*ѲduRIK\jxGվ2)-\x_1z1k2J" Y2sZMFD2laCwb~y*Dh}6ѣY(aoT(X%B yoNC7`Ӯv׳M߲2X!M_nDelb^[ :!><]`/7[zgyN0>iX7gefˣk.os4 O#7Vs"& 8 Jml :W?"N؃OQ\o/5`87kL6 kZq Hh^Mx3'dBi>xO j38fģQUx*Px[crW dTIFYjs9 yJ®`gIk |iWVO)z\)3Urުwi^ um2Ycw_&c, I"gM+hܱeai !<їH½y{QfpQ~܃YpRXx>m870LJ],R> ]ɨͤX4![ntA^/_0iEg)sE91tW{W&Fc36h'arꤱ;VM,n~[w쇛윁#M e جy/;x2F%SkuݨāQqpȅH^2GHϙ8M[j+7=oD E< q)0y&GAj!iu`}̠GQc j{F͇B=7-h+=dxUL5hQ`{ԡX?_:6 /gdɆ}}MbAHbZA =9ëÜGӆmGP8)]]OI Ku=FJI[6*%J|2vU=59sBK0YN2ݘpC]Rf+;vijcyTF^ShCLPʆ0&M4*D{G>0. y[4S@j6`ꔁ8M8ok3wu&Yg+׸J"ʑdm5^4mx׋Wt}yf!ao-rU_\">)y%{bUa:-q)-{5̴UPO!UK%/~ 1$А(;S7Q 6s>PMr/^iIƉ88಼7=16c$y^'εEh`ZϞz֟eh/GW'W8'þc#LJ^g¡dqo{#kDeo{ltp\{Xøs g-7=J&%Ma~3q=FR)-W&C]қHz G8Jlqgio"2 b7Yu>ruEY 4†L n0Rه~HmxC %5U !s#<])' V+Pp:V}uYg>jR)k0cRg?(&͌BZT&Ѣ7zޘQSkL!#'A=xȈJdO#JE)y]z4{&wۺ$6Msk2iwmr 5T Qdq$)*f{䔔~hJ)9Qh/,ЋSx+:[;@C\g뮶[0b@6ɆyQ2'irid񝹎i#e, s`G[d5V@:.AOsyP{ ޅN ] $ƭӴdN]7R]PS[GGCMMlKD(X.y %V[be8LXY!)AvgDaz=F(l7maRJe0EYZA:_a4 %,5ˢ{)z<\{Z6нe #o^5M^}l;B[;9&i|Oٱnm-EƊj4qa~S> A\{CU?`֌f FxE6Өu-N9)wg?a0떣Z':D*2{JO>.xJ_tڠž(UF,MuiE`u/Ɛ6Rd8qv d,TONao(`iVq/NV?/_z3nyvxeR |ur,Z NͲbkJ_>iTROv߁zgveuVZcْ~fM 2ubAtJt6(՜nV3Ot A ^?A /<Ϫ?d;֮nWCH5 `?U. Wq?1q.K (a_u'nL)W)@BX v}Rڢd`ď>~1KkBsn )fEz^mq[}Zz5 L0IaPvojUjmO%~ի p?߃88go8opzA]Cx\ZB13k_ت*ULrpg]ȵyٽuTL)2CıU__YQT.]Wߵ ̸vmc3=lQ[r{nNYMnr;?O$$7)~M5$߷R'qhMaȆ틽ͬZrMu;/Z5BUÇD$c0tZKJjR=IɱBsz^UjyUzBxs5J//fN+/ai V]s^%WÙ':v~' wZ ]e]2̘soi'ƭ_ljMi~m*4d~Mq4~^]wh^mcfTR+7|geX:`ÖuS+Vo/5=]M5Ej)5nlzvUvZ344!(ߘbl\Wdf䚔 LsaEJI04Me[ O4ϕVC\DTEf+n}TqUL\oR=R)ڏ7B:~Rq7Ch;xpmɯ ď D`e(UmLU봚E5ycƪZ ݨuBBq2n=4^oSRˊt٠O5kƜl4o)Ť0f2jmF>2P-ϩh+ED^511rP~dّZl'd'q#38yջg3r #2OGZ;fkczh ?rKvt;꺫6o7é2-۔۴-F]Y,5*-)'>">eGG~t*-ijl?ğqժ꟫2Vɗ擽hmlO75ԕz|(_6חquu9zpZrOkOBaʿ44PG ڦ{ DTޤ~hm@?A&T?Fo?e*^RmƧ&$XUOs5n EO+$^w6|i]n6_ߔf.%EnŦUB67oJU|ʕ F#\PD{32ⷀIyΆ<-%8,e7@p8 Q ߯-i';]g4[qFSZOCjCj[sod}Eq¨jq.,;mJBzVaF`tzMIceK]޺>-oKcJs*RRX۹gm)fƜ!go(.^WioۦTR9lїT5 ΡU`%-ZYBo8!eEZ[rN'+˭XWHWѿF 4npKt}J2*W +ߧŘd)w *q>m{Z):0 Yf*f=y쒒ny1@~~[|lB\Xb'+eoՃ-.M&JzBPb*zZ.a敞\|2m@ߞO+~35M.#5UV!, _!0Eh1˫s,%|{5)eⳲozFHhc/f;;bxofH 1դJ붖5V<5.738UV=rfgGo/4[ZJ7K[oyZ}PS]\bP6x䔧0EcX>A $h_&J a '>lM6[%)%ĿbLI1h!հ>4%D03Oq ܥ3U&"-&ӡC&$vUReKvKUzoTh_xy]p{auag5ye9ߦM&~TY2}-4KWZ"@s%i"J59OqA={[9$v7[F:k0ʲʛ%Cr vgjRίkl.,8Six@bԫ9n]Sc ;YWgVgfLM5O՚L8]7t ,g>Et͛%pC6:"[ky1,hŠ﫷O@yyv&cVZ>셑Ofh>vl͘ypo!USXKw-}JR]SdJ5Zg Y-i8 uatE|ϓI+~tkiyy KweQTńBkcknS/zeCRԪUu=}u&ƶc*һ \1(DrAikHO ^t>ݏc.=`#HϬMƎ둩:t6FO?H Dx-)ҟx){-e \~(9)]~H):q=*Њt9F0* 2JkJvXM_:n+{ly=PcJ*C_DzWlU1УNR{IJҿw'qtߗkfZPUA%QZ'%ԊSuH_{ -}IJR$M_V@0j7(5lXIJR$%)IIJR$%)IIJR[>4}ZDY$%)IIJR$%)IJYdAI!*WDN*"o@+:W;Y Dk$o@Y'E9>s((Kr@Yyj,-XڰrǐZ\$0 (+"@ fyJ:K90$О{# WdyJgr]r:B?( H %uu''mn109Ӄceq虘ti4&0߹E;Ӭn|u:$+'Fu zƎu'ιV+rU^pa 7zz}B㘏رZQ歫rgzc"v 0 B*} ͷA5#"'Ers{+'w͢%ŲW{ w鼂+~ŕ_<b3\܎zJb']~u>3"j!;NsS\ۋXL716E[%89 #+{V*I_=ڃW UzKb`Uۉ$銍^ImW\̃62ԣ%TSQ_ZA\%(i]'ҍ[5~gZ41 qL'+K:g.#n]'D %!A3g^#]&M')+FEs@T FUtC:~-Ȣpd:z*cH<^ڏP=0u۴ AI>st!Dٻ~v|tD;6wcd(v + 0 Q Q=6݋(~:8Dmh#*lD}آ{PguLND@g2>j}#(Uڠ?r*1#;P!^h3mbZ1O6ԪQ bɰ IK~<be;Zn[F_ѣ5/QճHD6x(!] l8$l>x,RT Y#Lt|kBކ63d6TWZ?."g?Pokv_7}/`}^PPt]ibq\3€>o*$x|nt@%[rcc0h'sޝ 3 y'A/gvG=n#3&%P3K:]!4v }ntm.u9.at~tnOnGn:]@ {LO=sŒ;4!FCn8֐kFz`Zސ0沇pI;aC~靚t3 -Hx|3WpO펐 !jk@C@G/F(Mr͆`"jVIwNpLKnj>/9`] >)L4 qz;=Jv0㘰+`T4qP7[lbڟ`PtMG.htxݮoQiV'-333IikCs~xu|PPdL9A|ɂS~ CY)ڜ0aK1ސFp~bT G₟vp+0@j%$ b*ctkuXpN9B54$al #M>p;&n3CBT҈c CV;> ,( 0%YnM'zgw&ZLhe*LtQ5)τO(&_NƵ2uh2 1]1ha>o4[HNc̸.nki8oJv"\+P/P3i`=y S%5eB4Pq!`8k$>D`1`+( |(vLRݸ=9vNҖ7dg9TR Cb~ 91#2?ɇvDž[nt8esSY[ 54O? 'p)xSаh,~ TaJhDK# ut`*0.AE,!)bq tka!nM6]/D KnqH'0JX8Et` .>3]o=@NwH38ChvEwg`m.FȞΡ!a`Pݽzvw ;`\A@'EvQa;{ٶw@;Oev6aOpo޾Aa=C0}Y:wwö}B>hC=m}}8U^@?z::sG' kɦzwmۺ;qHD6N_p@?U}x5ptޡmwkpSsˆ;jj!#B{:cX::@l1e5f=M>H>M>=01111Vg䃌u333{H6C&Do~~HC\^sÝQ~#7o2!͔_vFSR(FҀ_.{o[ȑ_\,F؆y44 9FB"8<ʙ\.9?C=ǩi.;q'ܽ\wkq ~NnT-{;Dlؖo2`lV ,m`l7[$`>> XL&- l AB@wC-l'۳ElC\`l[;`l7q6= NEDl8l9ml]n"Nv }= ؞e\Nri퀭liv7`` `{= `[lo?$bSf_opf\O!16lo`{/e𹲷R{|4}q [ v"`/AY*`[!Nl6=`:` ˀW*-^-𙲝}mi>S"jUv*V_=W V^ _8F xT,,~.̿__EU+a_xyllI?=\ Q*Ry%{Y(~:g^OYZQ˭#WF+领'MDZ)KRF%&^[TJ["&JͥK<0K%2V|sczg paU`F<ZQ|;s e=_>~c8ZpjM1Ј9!k;F$^?Jy*D=("mDt Q}PVoĖ*pr:QˉZ1"yrg04D} wHr\thK1RgOg 9ʗ#%h4cQq00Qq [G4JNZ3-'5nΜqlA8a >,K@4} rw_Ν֖33 8Ai08noϡ%Y38zॣ*kV-y)9 >;U":bSSIs*ыaZWUɆ#΋tD; Vo s)QgxN΄\iU-@ߨ?u VKZ=)jBԜVr2j ^ ^\ƦJjێpkǷR^%J@Z ս:Џ:tflzm~A揓mDⴚe`ED5|6|VMH$[ *oܵ`\.Wb>թ8F i2 >_>Sl :]^X_uTJ#b(N"8_ Xەd6cfȦpRb\\l贜NO'x5Nԫa@4:ϜAl4\7-7D¯fPpe|*'Xm Fcqt@t LJFx"%:-n_=Sc$#Γ+##7',ޠxIgB]AV}Fh xjH Lgyw koCv#/Ɓg'=-ѷt d{/D".H#w՝p8l: xo&xOUi9\Y2rk 2OG/ 9 p% z>FM0}l&M&peu\7&OsMk%!wtL̫"!r+9B/ZAe y`BYtqU!4&8_RX۳X|LӀhJʋՀZ_~) 7_; [믓Br¢e+ƶMlK؀aSVm;wH$v6t#Na a,a._'lL؜ a"aa ބ  G8pa:ń[h]Ep;^CxNg / iAИ #,EXaZ$ ސ0a;ŽɄ=$F8pN I,~ ’ H8p*\E+ uƹcm!MIx,e›&Mh!,@Xsv 156&lչsvGd}'G8pvglSR_1\=9 pϑ*_Lϣ#2\s?,>Ua87kK' `[!vSexU^7yo>OxDeDUQO4S a5F+#o1f n۝]]]؝_neOg7ΛMNn4"fy3l`0̾(s\in7W- XTkd#v-;ўdg{}e||}|#|s}?n*SEJWK&Ϋ\*W\rJ5!  *4*(=hIЦ̠AY*@pq)ÂӂӃo >B 2,$-$=dIȦ̐!Y*@hИкq)BBCn = 6,,-,=lIئ̰aY*@xq)×o ?" D:zI;p1r=yӁG遼hm|;x!<#O ,/m$OGws#1d¸l[16foGBږԶƒjWmmk;)JJ Z=~թ*<{<<!g#;ԈTmjj̿f 1~;ta q0MٛjOtz6go4S۳̶ʹ"Fh|+aOV_Tu v{z6*p\hDYsņ@E2^%t]7|K*;cީ Q;'*0G_{(T}Ek_6Q{D]?qztԣc]=mN8ym8FQimg.ztO{~iN_{遾i`l8َ: ,3Aċ12PnΕ] 騑5LՙJ7:f֙`x9<?! 5>1óhI^T:Ώ(F辏Ǖ#HsA]5q5RW(zZzicEj։j9}5LC#hk豗Hni4VG٩GSu:UhZMtN5-#O9W~~6j8g֟"^ H?89)w<98(? '}{ h`/y9#j/??1p>O$ȿvK_s5|AQw۳j/uj:x}3wo[(=W:^ʼn|#z8?/I KKF`39x@f _>7p;xB d _U:@.[99 > w}'~;x "7uq2^8’x6ZI 9~bsyXj]CTj9nqsֻ0z2pv]SρWcl.^5!< * Y22 &Zda*~]îX~^*$m:Ev:6Nv#R{`_P¶f`/dWh#?BvUGucq]yu/Q{ԥ^ZZZxd lTц[ƃx "2mZJ ?d" &UX."Y~͊bЗ5bK`a :@*{%`R#6#uvF0?4`4ws76a,0G0a"/΋$^׃W+W+P66 \I$v%!DE(UT!ETWEUQPT1ȭJGT%UJHUF)SO!PUExTUV!J=Y,z+-LzQ& U*W-UK(ZP\%(U"<:PR%$xR%d(nPZ(zPVU}Sj5V0Vj h5*j,TRx&'@ TU3LxNVT} ϫP_ j|5^T PS-RZCm{_]+eZm}jzj zVeP;1f4T1fbh2U&ΪX]P.AꚺM"PyplX7d-wrĠwH}k11ocEu!{ѯ@* 0>: {0˘s3 7.d6 M"ۛl]M#۟lwٮAh^*$`]C&{mW7lc]#&{GK vDLC7M=D+2S+2K+2[+2G+Vs\ZtȗZQ4Rd)T+|ZZo"jEVfV{Z2K"K"˴"˵"+"+"?iEVkEhEjEiEkE" id"""""["?kEiEkEvhEvjEviEhEjE鱲_+s@+99E+rD+rT+rL+r\+rB+J즑ro*rJ+rZ+rF+rV+rN+rA+rQ+rI+rY+rE+rM+r]+VV7Z?""YzVƄleLɳ1V$)rJnz+!g[QG,Z֢xGt]DW)A"U CP\GQqL'IqJgYqNEqI\WUqŶ-x4L.BCm-:NI" "Y$c&MtK=)Cb"b#= `G(Q(l13{-pބ >& wky:oJ$` aF~](VfFn#i5a{Pr!F2܆4<0 ˰ \Fe`za#p#l99PX y,1G_'JkZN)[&fxb6s9.Џr+|řG>{Q,KEX&tYb}G+ѿ蝱~^ x4;5ϕA\ ī a a qQ0XqOI0` Li>0fl?_< װ-,W|?B,CϱVO VX~d=l 66;`'ݰ}> !=8 8p 8 <\ : 77 p 6c_ 7Mx7xs[o'fX3Ylkn}iͳ[_[ oVZnVZ?Yuzklm~Z۬k:bNX3uźj][Z7߬Vual}>j')}>k%}žj_ۿ7-;˾q>>3}|ʗ B}ap_//_///Q_1_QD$d_oooo L,lۧ{O0/a|%`o>DG21}1qb~q['(nuJ,igF%tLʸ\A,c/}edyv_197gKynsy~͒J!( u1` zg<ZK73 |j们5{ woD(@GvkzF fO?QuzOD\\TD%%y*^jeUʼ2p^Wk`2G#m~k~ Ҽh^q(FMЇɘ"[V|#?r1EW02 8c?:fƖ{/h83 F;0~猊a=3Q3t;fobƑF98n}Gqy'vq;;~ĎvQ;.h Ev1]Ѷ߃*SYuwU.5ZwacXcrSL>OʣQ):fAt8 ǥl$+ak{1Z5k O-g4CփX6M8 y'=y2 y/ 0Ca8|<?M"0D(EIQ~eE,dPNvӍp fy\]#,uuu\,{{(=rvc'''Sܟ{{uqoaww8> k-}s>2ZVf3YSS-f+rz*h;0dG~Dv?l`O)Ja*1_d/bpjƱqhtuswp=rtrvq=*zUUUIW)WiWWYW9SlvllLvb;ʎ;N ;kůM?-%nmvt&L~G] 3񠪕0Obcߵ6~\ OPh0{rT|W!bAh$gX(@o<D|mn!YK"c K'sz`6|8< blfj(6 o*O3/rZt):5{/l61Fhcy,fx-1=-;14Sc1e2gC9B̝.0!yO?Ï?Џ :їJ@e U7ۗu/C/RWĺ ^2E=rc~$˃ۻ~/+fGͅE},d0OAQyi)iYi4ƿ>g/P_ĸtjcTESO_lA=#OnYV60-*_tq.t.^{IXtmgi W) W_#ڏ2'B>\-""s)DJĘsc70cL~]0i|O#?XB#`) `FK#-X 0;1)˔㘕Xp`1>W q. w{[l}nwEwqEݻ"bnPJ"wI ;dzDϊ{C ?drr<䇼LC!"?PCM~`b*XJoa83Y8kSgz{Uu/00; # #.# "Abpa}Dvp1K1G QS$,Կ{II}oUwު:KݥE(mE-Jxt$1Ms@,UQqR,^o1o1>%6VؒkմrSj>4.O8sL7w32py-IG?NԠͻ>ZV~-qcot3Oyn'&9KhK,g9 pbb/Yԣ>ԣsQPQ `j>ǚ泼@-'Q_ dZ |uQw Hn#$ m̞Br #p<q Wǫ5qAiUwu`+3]T11O:㉣TȾ8%bе8t5}VDʭ Fe{\!6[(4Ȃ}1>ͥAbU ńP>uak5Zl=[ump]p}pCpcpSpsp 3/_ q7+⋤EHF$6x)вЊ'CO  =:z!t^Ї C> }["FAfao2ET3UR{}L4 Cȳ iCQSB Ԑy 8BU!j,8UO>䏤>frƚ9=%詀ZS_ذJʱ.G%Vbr`@ h2t}6Ҝ'd^']dYUaD4wj^$b@DXOJ,L86yhl9\6g^9vn|}X`wL݇)IȱG#(V'=N+ (iXǭOXBke?o3,K?kdgVIOʭr0u'U"z@%ͲzY1>~u}O]c9 S1Ъc<_5_-_ŧ2F,_U1|[#Y,w#oY# BAqmKR1Z"/c]k~J=)1OCP -(HK#0o5'#tsHgiU+o3b5O\[@ ]0u:X߼%|߽.oZDAa5S)H~ʼ|V"~ӊbK'wIQ-y(;-TCt\_2+Zߗ̎v x=DR{85ij/P!=19f&۟#Go|oOt̞3e=L{&Ugmk˳n}?T^h/"{1հWҍ*{ c+ s_#T9CM_}W& 4rЗQ7]b7rA: \*-# ̼"o$Q-Y Vʭb}=` pK9c8vvʑbF ?|͡'K8|q>ak&g=Yt4/m58ì/Es1;/gC9y&[L5.u\.sz\ֳzْZlO̳9۲ͱմư6\vs.njseڜslιac9[ڜs٭\pنmeqfObgXl;re'֖e5|=C7.ٜݙisf9wobIZvo!ݗ39ȎySe){0.<,IK4U3S p1Ves3c29tDL/XVQ]ז7vk6֫{%zFw5M+L6.m~ڪio}5- G?^+m)7O'`FNFnj32dl8q6@$P?P(<x9p>p1Sf692sN̽ey9 {pTpVCB Bk8J}+I8-\#ΒpYxQxCXgYYe=%dֻY_r\1KjYbtcב@Ar RσRH}H ysd?@{@9A99C0@{#@9A9 y@ ǀr̃ /x@9AN99 $E /yуr )ri X$WcL*![ml1|VGR!VlcŦ5VlcŦ#Vl`Ŧ+6=b +6}bs3Vl9]I:4 CfefeQ-ʣԑzQ q4Bzr|l!r}l!r~l!rl!ul[7c BoL!abXL#iFrh7t.t%Db*C2_5f!IY ʺzP6P6 fhVnm^#hcOe{+zrkցʭ)mB+8Rʭ籕л!| C>^v*yYX68$ַ [moa,uB۞Z)hcUxFxCŬT.ylIjYELM#jm֣XYX[kkԈ#?5RkqҬ)ysC>nU*v:Z ^qO˃ko3şV-{hcDjL>UqCo):Rn>_IsBC7o~L;̝boN3wb1wSE>D3h#f"桙Z"`PC塙Zt^TezڜcqO؍mlkaNrٵr2{J +W01 \W5=b]t'!s= 1Xc-hשkV3m }Uv:kV8eSC6W` N\zKϥPĔmx?qJM^0sH0u'&)ԣb'w90A;˲0Zd@gEn }A9)an|z7'SHoͣS1a$kxZj>^,_t*w:ڮ3{/b*rnnq-ހmu;sf+ϺAQdYy'[oOf-$x<YP}=f:ƽ_J̜2+܏rʭ̟19r n6WQ->ו1TўkU8+ ib2 F$_]-'qwe~#}W=UěIOQA5b5vC]t<)\.@Sr}LZbXғTPqWHΣ *wzJ$=k#hg} / SGy ~(쎲J/Y-am/lޠE H+jIPH - )22r(qTFXx|j>$UhKx0.s1}9 9WH>95FE+42VhŴ7qd5WɅ ߼kf<,\yEI$H_ܥ]Bn yը,xGtF^ FF!==xFDF7 LLO)d@I G1gju\=_Ig=#y3z!9=}!zY[T?_j5GݫSsQ>UP?KmiN~n{^&[}ͺXߢD =Xizg,] "Io[3zަz>1}J/~GJsy[~_? N5Sùrj;N'ǩ:N'i4q VNkaU9VNasd ?F:T5SݨZLjF]j?W?UoT' ݣ3t5!Lߦn=VcN{i~A]9/^%ӿiӐ~4vNS~Ԉr|FnvCnG}9_!yX_/W?yQ~+/?*)RBYjijf,UVRL-W+fE=quBT/S:~SSԇ#uA^}kB7.tsBԭtkFt{AwԝtgE[D=Iߩd=EO@?Wz^zި>d:A'䄝,'Tql'HG9qw\1﫲!?ȬdVCf bld62MfBfA6!5w@R:r\& R>)OUr\#ur 7M=;@~(?'?3GF1jƫ jTea#D=UQmRAuHVGQ:~QR_77u^]TߪK겮ktM}kl]G:WuFC(=Zc8=^O\=O?ez^+)ܧ[}IY_WU}!G8sd8{ew{; dRt[y펁LxD}Lwf9c=&y?~i'y^nz: >y 8vMGUxsCD~V6xz{Iz*a<U*⒵f(w"%)TsYNg9QH-{̌},,I9 ʋ)㠜Ht1 [n?[!i( 4-k!-`[߆v;=y3z]Ut=Z,ߕ\XIu,"GV؈#d8Xu2}9bM͡ <vM++:5:"R;:?:dVR0w89)2Ls4.,0~XvZ'G͓RI[LFe;j}er~r2-Ia)üfzT]WD7`dYe5ʑUEL qQ 6SGP ˣo>lA5e+ٚjv=Ցe'gՋ>/5j(K8hxUKğN+6Rȵ]t?_-)kh(~n+U(g'ݠt∥5hώ keTZn7$YnD(n=*W1w7n-QvEm,Mܦm.֢m'N[vn½ɽ$GsMlq݈&& fkV28#-wxZ?͒]WSzAQ&GzQΤe]lҬ#laK)gM&9>k ̷xm #c#e"7' 9R=]+WUeS2 gKɼ¢\>!y3/WkUa[ &Ҧ_nq5 ip<ݜLR.d1rh9s}?5 ǦGB7R3ISKGSkp-8۞8u@\3vu͍ͥ|% RآT{4 --[ccORilUl55_Ldc8n\/buSs0~6_yWĖUWSxڪ6j@g"BXZgIXGg>SVR?_dQpO~2VSY[o`MSlNuow#z^[-nǺ jg8πWf@"؝[2+5r=}̼!w"ʃÆU9_J筤z^E]s"ys~odIeN9[Ta_r4|G"rOM̧@љdc.&xno i&z\~;;܆kA'D˄XKf7+>os~ǔX3>{LĽ~8( 10Q}c"6ŠESDR2r0o9 ,?Gy ;| }Q^a"^/Ǻ3tyT eB*PaGf;D>#߫?4Ϭ|jiKdi?dIOeD?qf9gI4_IqYpg3k¼>4fqfqcL!3[%fC#wk05 l3k̛#<V<}=E+DU#bn,U"4t6V^ 9W yv܏խ#cy$w^ww}׼HӁAc9^qϥZ ݟ+{掀IzԻnB@#{r:K'GǮ%s_qPתq}*f;1ȶDUU f7DT[ X)R5yy6g5w*\'8k_`MqnTf$2?E*CKAHܣW"FYXM vϻ穥{ͽF;cXmd)Κ}ܪ?''R,w:P8Q-xU!^㵹xxʋFAA,[㥔E12>>>Z''Rj/Ǜ4?eb,]ycj.*?{ǑFiȖc!⛭\gt;Gis9MC۱tOo'>4 c?O|a'4_K៸b'V02 gK@lI9TiS(}wMIěRh>;#ڧi]aũ&0j;3aggĥHҫ& ADX;QPEP^"*kAD{AE;evE}~}g%MrOs9qܧ\˯ GhnN s= @A\D rH!Mȏ =sUgAݥ2n'F@^9k}pYxߖgmU;Tyf>Ӿ۲i;feIFqPi?ūAj%f!$[)1~s|W)QeP:ΐ[yoOJy|:Du*!J5.O%tE]J̋"WTE?y7TOߡ=Cj?{ާэ>ꠏ럨>.Wy>;wq<~f1+Q,ZV;˫x5x5x׫Ai\%7F fIdq/z}}2ku}bdOެ^o_n%1oNޗ+*=>́NOO׀%j ~Q7h_D]SN7ڧū2$w>o۰cz ḧ́Vp\VibW˗-6/S&/c.@!cyo?JL yW]GZy$t*t9H+?(@^(5z+3/$$x{dMx -xmV9@f"異3Y̳jvyn-Q ]KyHYBy.,deM4=g!+Wo3|s\_y9Ny}n`./D76MmjcZtezQ[~fy{mCVlKVEJ"W;'n©d">+-^[d;IPΊhs76>Ø c\1pbˆvC.Ҥxj/'4cq2QFQQ e(cZh:1(5X{utOfkߩy3y*̛+)wzTu w(!' ʈh zž'K|«򯭘쎀x9ʙЯK=ϻǿ\ ڝs"Bp|Dލ\iD5DQ 0~ W!9uG6Y__R>.(lV"BLuFhF 5eS*x+ydIx)1ZfYX9E@JRr@YoqB9rlEwc8SH9&eRNŤF阔=H9)Ĥ|1)kL~IDrǤ<1)"bR>C/& bRDJ\LWH-R/Dm͊}PdwR!xW{sF3pCb4}؝˻GG.ts떸K(]I33>>9wZw-{Ѭ< $gmdUb;=,1i>ğԿCkR(=/AʨeH|ǫ/$V+}vc|v+|*wYvƮ$#\HvC'x7|Uј{2?u!םgjO4 kWYԘG;]Fn4lft)Ik\rJ(vmsOs%kF+7WD ;ga}y%'@6)3'iTܗZ9Z2lRZs֜9/3ڪ]W3|2d|5d2d M\8% -hE+B.Z rꐋք\kQ}]_7ƺnDMu;ݎ5םugjR=zR+_ )nIq'H;CRnditd!; ӱ靐ZXRleyAE2""bdBF\*W35 # q-ylv6G;oD;[772؝x_2ګ:cqٜ0[ڳq9|VC]. a5@ ֲg֯t8Y$9ǓUϲPZ,BLw7Ў#Puu_}BEEt5(= k@A%@%yP:mZڦ1V8^yzCA1&`Lǘh1c DKAMv^>0&`L Ø11cb$(cxL ;p=QzM&]zBT=3 }{;E?c~tYC1z 8hkhk%hyjZzFf77o9(=û឵{>¼F

xG3ҟm̪Wws ;Z7gA/WcNGu=TsS!,gKBkPY5>[i1XĊhl⻬ieǢDcc9u׺OJx\xFv1|p?ҕX^gFQjnScaM6OyHSڸZ{lk1qRtS)  & ˢYBed9YAVUd5YC֒ud=Y_6es]}e,rMCNw{}r|Pΐl+BX.er\!Nn/ʍ|C)%-ߑC%O<*3O$8*+' 8;< M'I8 wSS)B NI$%ZZP@j zzS@@_@ ( PL)Ed b)Y\'-KʒddiY\YV,/S~YQVLeUYeu*$kʚt-kS+Rayd#*&ftEBe/ًJ>d?*%ATZC&QY9JrrCX9*r$rC5#%)I<9rՕ"'ur\J j ORC|ɕr%5g\%WQSZfr\KzZ R$_&Zr3 _ӍrBVȷ[t|[Mm]j'm^n۩!wPG:ɝr'un"ʽUfyXnkWak?ߞk'%Reޭut*zs4zgef숟gSթ9qZk&v8;'/I|(Kq'qCҟF9>Mn?/$\nsOK}r?ý {π|]\OHO}S/}W\d#-gi-Di+K;,? [7t;4C6ezJj 緾=ԫXw >3ZGKy,n0by[UՀՁ55u7[(a}^-/X/~b/&ibxXKr=Ol[iboO d88N#:ŝεLex&h3@GR4gHCg G,twV8[6#gs9d8s>/їӾ"*ZVξ޾a1;}|f--=[{omvN>go|?~?Οǟw $䭈c`q` `I`)`i``Y`9`y``E`%*jZ:z MM̀́--[ovv x+0      8q S>|888|880Q<|B"bc%ǁˀO> |,9*5u /_n |*p35^[RJd/__ ~.}p#Yiǂ^O.>   ~^x zKRO}_zW^~zw^G/o5nc|o&2V6yL^#M>d&لDL~Sjb ")f1ڪeuzvڡ>f<̤&63n0wqf`&$slJ)mʘ)o*T6ULUST75LMS{GS5Vikڙh:V+l[LwsazT!'?1o"cm꘺7 LC46MLS47-LKsien07{sL5nf&2vk4 0 lafaFQfPc\w +0;̇#ivfk>1̧f9`ҕ㯠y^~Ď{={F=-au젣4rUό%ijMs#a=ѭb`<^>~̏;"1+/:̗bμ=J 1^LbXZG'Gz5\_ccK!hE5VA3g/WѴu3Kp/)<6˓慣9QWG1ދ'zi c2/ /z~RنJ|Z@ ]WBVd CS0+a00+a0J(a-!KdMaNl̛>59@{ߩ}sg? N/:OLjKLjKLjKLjKLjKǜ`..>\yd p"p%MwqVI6toĥcĥcĥ[-hEr:rD1ދ'zi c2/38[%} jim#xG1n^9V^]`?}AQsgk~SS!=uA A<|6+ p5p2E> GG2;eNS;eNSFN4a=.eZc9E=R,ERㄵc|ß}f>'eqUo.XXg V6"F݈w#nysx]}Wp9\}W>FO]-^~Myh" sceڒm$Y Q9{.`gWۀbyO_]8x݃rh8 xB/WV@)b(༘sf\t"Ts;W\ssx%x a l]y& eR&ؔIU$z8uzEpkjῨ+x6\K{0s۵Z][eX''fzj~eNuܻ)Gkb8FweoCI#ɑPDELč\))).H8R#WE ER"EYE`g˅ᄁ|(OiubVg+CkW]B'2O?!Nrgqp`A>q$\Dv'cl$9A';a+puxu;8^)"NQs NIK;.Se/xyQsCp;9YkFž&p{M84Ќ|恞O p'sf`J`3_ 'G`|$% "_OȻ" ]5MoW$YGxsH*Ԏ|Is::&uxԅVɗ=)g=z$ɼKKtGď-)GʣGBœ5yZV̄ux帵ܾggd%&RR'ɞ e,,,,,,,,,,,,,,,,,dKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKVh8I}DuG@$:-H %t@$-4Kx%VŁI4^$@ŁI_$@ƁI4a$8rs1`OVKj8Y-'%dDuKrN{Z"WKj8_-%|DKcsk[iӜm}C Ul{*:J37Y؞ax]'gW)'+ѵ&k[3b | xҢSX X ts@gp6i>ID`!o3,<ПX;&n9 B@&[a5""V)^E^DJmUj J&( .1!U?=g]O}?sΜy3/mNkw㵟:xcN4^3Wx]&w%*Gf؍o:?I+zd%F'|+'Ƌ8gI%~J!}>{gt\&^㚼6&}D_@('A!be{uGׇpG?Zu@ce;b&:Xs k+F`ghllCviK&"k'd/z)B<"M})w7mZaZgTf:md922/65o4ng5߰dG,\Κaef=mjgeb+-ymm{}s>qEUݑh(r,w|8cɈi34fb̘1+c6Ĝm1vsqqq\ũJ|Gů*\BtBvB~Ba› ;$H'\OILNM8! 8qE͉;$H'^礐48iBRARqҊuIv$H:O<8yBrArquɛw$H>O(J V&(JBYlVv(_qf: gssss>28eBJAJqʊu)SvH9+9V،t s35B8۽v3umo <&Oh}Ő9yoh=8z=*IجM&@z6WXã k2uNVڤFVk;=$>bos]ZEږGƞҋܦ=QL3.+^lʿQ)Q-jӝ͕vc,,iK\7(+m1 Ҷ͗V~~[]exS 1GZo;>qD笧$S)=v_I[&)ieb|6CH+#;^iI2\}ҞNA'q i ](ji?v{CgcO5tF11̬3Z%tVꙐ'Xi 3-vrt I+W§D`Di 67lEOHeieIϤ,iVF3I~VKZ.[o$vѺ(_c8'BMb41e7yiiTh*6-e\N5m6m7020303M9cV̙6lsWsywr%y,Wp\ǥ"" E2GڥҾ!}^Z ]yLZՓ>6r ˂Snɐ4+ViswI+7q0f43fU_q)MzM/2kCwvZ' lQMF}Za O 1tÕoph .~t w}0t\]-uʼrw}`kf osa3k˂v9hלhL0E7㝌&u?3tFtǚD=z537+_Aѹx 7[i|*3Bfk2>i;rCr*h<;voپl/ʓ[_|?go2~Cs ༦Wf2#Igcȝg Σ2Cɳc\yty~X%XZ9!v\C( ǡ2 cB?o4M/ VVVV_V_oC?J+f}xx#:f<׌'i#ψ iMfT`Tyf=si7f5A;*6nZWLy%g¨!Bώ ϚZ]V/ }#^1>/&Cυ(l|!zqNX}eB g#7Ic4Y7`5nChvBX&Gy\5vZh/l^_V_V6z}sh}RDX}|X}khe Oo 4:>1=>$aC?VV*>%%^VDʓiaq?y{c[[ۆճջsaQaa auWX}JX}ZX >+>'^VwՋaaahteȁ/ad^=ۖűˆEyQr>Sg&ޘ1żcNaS]qh3W Ӓ|o֣[-(bO5)dLl,(])(S:[%a,kQ6W#ĕ.XV(Acy'X;aE٬l,{)r*u,4)kRzfIS2K?Y-F#mhY,_v{r>V>}J;{J?Wɢ*_5>kΝ[wl,[h,ceH)l=M[J{Zݓz"3JMPʔv|kw{W륝ޭ|mΎB۱3_ǡe]2,Jn1݆v+Y/֜svoAq 7=W^kdyg 5*ZE5)ݽMH~`klEգmvvͳԶy%g̓.2ub2eH`H`hj 5l|^'(ӆ8jFqW~Q Eܟ_1|p/Hg}~# FIW=qS/7vss9tgNڹ sΝ5wUs=]ؽpT2w=]^\sV4蕢EN{L*Ͼm?mK篟u<۞?Pl-N++RfA ,8® g,\зHY4~цEՋ3OwU$V \J fԤf%]o=?,s3Mi{Rא ذd<2u b̞+c%ֵ?5n,y2݌~zc} n=EN_nj1UcFO z5n q߶xrKof|7s!zlz(ᤎdErxSQ\Z­Џ~_z~zf9XlLmSoϧ2k1Q0;Εz?5lFp'3,VU)1Cr繹$8o}Qz ޙѯ{W{I)nӴ #uQ3Qڸf5e=R ad~-D =+fă+RmpƴKtm+k 7J5Yӷ$4dA%8ҷӪM ]M[c'jR]-{hr{ cwmR.Xn]bviܥI ^R. ,1%M3+M>ӃJg~^[ȳ=tR_ ֳ8Ϯ{©)[?){`1NDӔ~nUasSOkE/aŨe˓M}6itsՋޞ'Fo.n)%fPܰYK?g%ǸZΰz&(zOd l(z{OpOcgrz]4QGb`r778zyϬ7tޮgY}Yh-Ee[턙;UyaaevT8&- viK6T6M>!LSD Ӣ-r@+&FD6-hO[џVf(2߁;Wg8xk%ڻ`FtrQm]kh6QQ$"EBOTj9(pkP `!(R,`9 a|7{M _䘆 `f#Rxeȵ<&b,@̴,%E"]mw{>G 78'EzdVyZ%v[#v.n ̄gavbc%6Vbcȱn?w"'H&(L0<1ZûȊڄPpbL'aH cSD1wkvT^8mmm/03&1mie s'Fhrz(|e}#jϖ b1ӪZ$6"I.i=Yz{I/bn2^r%Wn<=%lx]}>DYIK?g5'$0*Z?\Z.CX"nƚMʢzkעC ڙQ0Dmw$4fc@!"P/..e !5* ޯ_+M_EQEQߴQ'( N33PhuA:"_pI+o黎2E׿FOxbPPꪰZeI3j+-`WX Xɺ13}L313}L313}>LLLLLL,3c̘3& yӖY ?7'o5>fYc5>fYc5>fYcP2 }(@5P+R5|DQFԯkDQU?  EQ EQEb(bJLmoda1{^ߗZ_[-XI}RaT'I}RaT'I}R:WfWffOfOfOfOfffffƳf+YJl%kɶcD::[&lP }.QSaT;NSaT;NSaT;NXZd-VONN*8MaSJ%{ޖZdS''WWS+J@OaS]g=>9${f"]Ϝl9{V}LkZUzg+yV:EyJ\@*Z3S>s6==!?}}}i=ei`,8 xflO$2:z_{j)*ιgΊ gtK '\'3 ON"}lCg]xACȅ 0x£`0 0 jU_:xޅ}~^-a|al-1lO`"Re*Nv_`=\3R牃pn3s'jG#vk {௰Jap|ZUtB Bkg[ZXZCF`wnޗi>QsnQwjUQ-.h wk Q5{-;Ǐ ^:S½6ZCY;m+DA4XxHDHdPh'@*A:d ?G3h}73.cvЃka<ة{v`:̀y"XL׸H 菨o\*ڒ5 ?lNok*2-HBD XHΛ! A'@*A:d0ZhLwAKZAkh@[dkA{t tA9c= zB/xz@_a<QȃA0Pp#aƿ1 `,E ",2x :La5/ %g;.oa=|#`74m_> lv\^;/ v_a/>ZH-Y,RK~,,@:?} K:AƋ E"xd2^/AƋ E"h"> lv=> /N 삃">H'@*A.Y_% 7xv[рlVk}{b-1[,mX` xrOi}ρZqZ'ٯW~ P&GlYgqk*zzg{?9c[9c[Xi@+ QqڥxHDHӮFCpG%T#Ȃvp?:c@W2o7Fh@D l`@,A<$@"$A2(H4H 2qF3h8V=@Ɉ#;9}gL\ݕB733~tCxnv5zcʽxnL7hΕ>w!,Ŵc͓kI_oZ5|H#oM\SiwgiWmB`3 -M mvl"דE<ټƮdKZkl"nyzUYex})_4~AX"R10g@̄YP/i*⛊o*⛊o*⛊o*⛊o*⛊o*⛊o*⛊o* ໊ݴQl}aqoMǴ/SxY+%|߄}oR|/R|/R|/i_=<,i_0RUʸJW)*e\qQnVnwT gI#㍗f:o3o̮zfW=btUU1*FW2nqe(F7ʸQƍ2nqe(F7ʸQƍ2nqe(F7ʸQƍ2nqe(F7"UDT*"PE@ʸE_" .8L\q؅V0ZFDcG4qDcG4\DE4\DE4\DE4\DE4\DE4\DE4\DE4\DE4\DE4\DE4\DE4\DE4\DE4\DE4\DE4qDcG4qDcG4\"Px!/c'>tb ؔ2O mO?2/2/2/ceq12Q8G(cL'ҡ`,KNA{ `Vnrq3- g,v;תŰ"X Kx`FAntFAntFyA^tEyA^t8A3~cWY㕬Jx%qs7zJn%k[ڭd*cWUƮ2v]e*cWUƮ2v]e*cWUƮ2v]e*cWUƮ2v]ez DƜ{tBt#/UF5=NNe4b,ѫzG ҋ^/xK/^zҋ^/xK/^zҋ^/xK/^zҋ^/xK/^z+D"}?+,'xO2=ēhwA;vʃW*6I88%ʪY?=ղԲԲԲԲ}D_%*WJU}D_%*WJU}D_%*WJU}_<1 xS0 x  , ĆDW%*UJtU]UDݿ3py!sxPvѮ"b1.!%jZ"ĺ<%"_̯cы~tּJ; 8 8 8Z:Fn(Er4*Gh~4ڏFѨJШJШJШJШJШJШJШJШJШJШJШJШѨѨѨѨR cԱBX!u:VH+R cԱBX!u:VH+~4ޏx?GhѸѸѸѸѸѸѸѸѸѸѸtUU;rߢ\=գ\=gG=\{_Ӷ%P ֡`(*֠b *Qя~TGE?*Qя~TGE?*Qя~TGE?*Qя~TGzTGzTGzTGzTGzTGzTGzTGzTG%?*QɏJ~TGTATATATATATATATATATATA 0VR Ѐ (@{Sm D6             : D4@tNi W W'㤮{vg]]&*5Fc1^kxIISԘhRSj6c50 x r3x(,UkĔ"(:,.C° wEq=~sX31"n@ 7 D܀qh=@Zzh=@Zzh=@Zz he%+䯂((((T]Lʆp]]]]]]]]]]]]],QDK,QD+P P P P P P P P hȳP,g< Y(ByʳP,g< Y(ByʳP,g< Y(_e]tG/I{2h\=cKXǒ=d%{,ciHjKX^mG+fJ"~|[rSݯcOǷ׻<[4=3:82z)[c&9NOlVs]'U}e]e]e]|/{)K^R|/{)K^R|/{)K^R|/+2+2+2+2LLLLLLLLLLLU=ZG\cf}Ŵmٯ,1濩4]FS} MnvӵݩJm tk];Avеtk];Avеtk];Avе|̧|̧|̧|̧t{7ݻMnwӽt/ҽH"݋t/ҽH"݋t/ҽH"݋t/ҽH"݋t/ҽH"݋t/ҽHbU=4~7:v O^^}_ ck__ w o$¶ĩ'qZx"qf)=:2wQWZYI"_]/eezыn`7;Z[Tvyn߃wBg Pݽ8#p $ o5~;/ 4~CUhF|x87b=N^Y]c~ݸӡ~RG{jlXgk7y;Bgc?ΦaPc +M7{l]Mb=i:9V6GՍTQ5GnjU7Ru#5{Yf%J(Y*TSLHJ,P@,[)`9 ([)`W^z1bʕ)S,XLR1ʔ*QDJ*QDJ*QjR*GR1bJck1KbJ惿ГT~n-<{L³/gD"duaN1Qa1Oy'>Cy\kOãHcrQ5{;uk-2KjsyP]kwUc춮u+tBތ;]sz9<gxV]v;z1ޕ<]<'^{/*"("((c%ސ°pMBMM 551/촚/Z\{W)ѰBF{<>LJLwyj.jj{m:fy>x߃RI_`~u:nŶ0) /6 MuDZ^"򬹫i&lfyE_:e~V _E(i_}yjpnc{;oy5oS5sDM[Y'YtVUa/e9d-?]JȪL߿¯9l v:n[ooP@wt3oym{Pr(;=CFNj 2vA}^- j;Q]ZTV .<#&TFQߕH鉏 aoG蛉c<DG'.Řy㘰r *J"d(/Kq7-q'kS036<\g;>7ã7>byތ0JTREX;=~7lh܋ks&~aCSqP)fSzG~!^ *|A/4}w8QsOX#ɰئz>&nb&n w㞰0W/FTdQ"jTyuqG]ad $:ee_""Y.+۝""v(W§EzQEuHzT%b~.bDZQ9xs.'j,P>F/ kGG=]\){T+nݮzPV_ %y*oJ|]n[뜕srv@{\.X(,]VyU[ך^V`+T5*؊z=&*ؚFsG㭸 wJY}ewߧck<;~!?_ȧIN=ۼk!\/<_׶|+Ϸj;^n$߯p+nʱ,y=JV%V|1JU|+yl^/Q5GT]';)&SSm|#fxl#{eMZ*ʬ|fl,F #WSL22jp Z\-lY[-뭖VhkdM&Yl,*`kd7d7d7dM&iIvjZeV YiIVjZeMh,2K;+P)t ElQ 2CRYj=K:evZRE~;K"~_-W"~o}h$7VѾIW|(o]uƕ0%vo"jz狚=캀]R`^vmff6m;ENE@Sw|/yN^^gy̛ЪV{˓g}g}zy޼F h>ͼw's{\n㱻)}Wxof#&;봳N;ի@^W2juZ]^ӊ:jVSN鴚Wl1_Kv 'G%vvwT~wL[*Ӣ]iɝ7&Z{&w[ƒvή׹syg2Fw6sS|K&FEãEyAi'$#+e$cPINvn- "  "  7~9&2Pvys7xs7[ ŀLRW6l]z=+;rvsYɍ;vWR +% _nk8tCФ=qZVO]zX6=c -ְX=M>Q&:8Ϗw|T?3)E5vGun5mD5mX6f۬c5lsq}7f~o{ms=6GǹvbYŝz9?U:Ghǭ>yu^%Xg9`l~PW^Νhug2r*PeJWKgqyŠe?KgY//h=f1kYV:ļnR[(B^_` +gB{_Cg}}gY9-ǨF6{~UWo^+^jQ*{mTnrۨF6 S/ۨF6QM| f==uOsn5GGU>)c:ܣ}>e~*Icۧ}>uOWԯ>uO4XɃ: ]+Hx~j۠ìoU?8˻/R;:J[kU>w[s6n0;:+̣P?7qҰՎ{C ' ~x>NOwu;]';a;';eMwt;Mw;hOos|LOdhZ1=\_oMYsڣ+~?-%_"B{^+[sz*zl=z~kzNS9e=N9gygƊs w[ ׭tbq3+M"+ү~{*Sp p 4,p pniXa[hEy3 XfiXa1:jTZ'rYfR"9䨑F9j䨑F9JtR!GrTEGg=vcwU\tyó/AkK^2G>2m=dk#h2|?ODׅ{qc E9go `~ԚC{I8q*>i8g,OYs9|/p_a$_||  DG׼^YVռX2aUpor.u3X{MGS}$,tpxlа>PppsvpoI8Wu+qƅ'릆nwh?>?'$. 0]o6Y}1ryb<\X.O,Ovdo%Ї&Ie5td}r^.b^׋zq^84,c1?5vzӨF4O8)VСtX["֖%bmXkkToObn[ROqSQR72uGCT?0'F\s>>s\>>sk$~>OoIZVɢ3Yt&62]ƢXt.ލb):UVOGGԞZ{aNqQtx혰pKqEEve}ەo95ɌSۢthXoщvWaxmǞ(\kq  ;ZIŤh)} o"̩~'0S4':X~#̑_& ]ߪ;`8N Nv<gD)>a1G#̑?s䏹:TwoWLi3Eڔ~wUY^F)rVl9"Y,9wDDДt?Cߵ|>5*LWj|%u#MJܤMJܤMJܤLŽ}131 ~9xa'53<CrcnM`"&V܆q&N܅q`*}131 @tx)CGMaHtnq(x+&몿|rtOdlҲYZ6Kfi,-el: r: r: |e:N( :N( :N(Ȓceɱ{&1\*V?ďpQ #eӑHtl:R6Mɦ)4%dӔlMSiJ6Mɦ)u7ݼWwn^ͫyu7ݼ;\ooooooƲ4zl=-*Rԍ"FJ؁^bgd2R}̾Tf_*O'eD=}VOgY=}VOgY=}VOgY=}VOgY=}VOgY=}VOgY=}VOgY=}VOgY=}VOgY=}VOgٚ #j.W5-~2*QF%ʨD(eTJQ2*QF%ʨD(eTJQ2*QF%ʨD(eTJQ2*Q,bXnXnXnXnXnh1K%Z-fעT`]RҪPU,]kQҵflj6Z5]ff}K]Fll#Uʯ$=qx<Ѫ-+uiU.ʥT*Jl T]ttw.zO4HKriU.ʥU*VҪ\ZKriU.ʥutA']IttA']IttA']It҅'gs x$T9G#]-sW*REShJM)U4Tє*REShJM3c}fό>3gX3c}fό>3N n؋o!&T*DyʜQ濬/k˚濬)!gJș >rr&J>V%;ȚY>REOr{B\HDi>mș(r&"U"g܏c>kM9HA~pSGN0R6yL9G3yL9XXX:yNG~M\A7!g:N"Sp{*:i&]{evF֮ j_jD2?KR]}ָSy4X_E3tQJ}ǁJ:0,NK\wQ2,h`*F#0iGpNDbbM­ LƝ wcJx!ZZ³5:ԣ4#P'k!KjF.KjF;jF;j䎚q. 55bf<&F܄q &bnmwJ4܇130+kpM;YfY*n>4KGw1' K?ػ=1Qbl& C ÒsɆ%S!&Ðdׇ:olX\kq  zۤ6Mmzۤ6Mmzۤ6Mmzۤ6Mmzۤ6M.RXx+"VbևvlFd ¯0yо.[7(4xd3q;l1~~x?/-h/au^kǯ#uJݯC?vbH#8W™arpn4:ׯ3ۧt/U>l[ѩaWPԵYwZ:iOۄ(~'zrf4(Uso1&azK*[ʔqDȺho"+GZ6~4o鄊y+现!o~rW+=Q忛TnTx#16+磴 =/]m {!l}tBtAC=4!hDAKˉKq[C+uR[rl4"9W':\0pc4,?>>Œ>Œ>L>==¼m-յZi|ؚX.^ܱUwkcSAW|އE״Ey#vYgKͧT~9qE;]kWogF'%f%Yt2$?<'$ sJ(ν7!$$MQ]feePDEqaSDPETQQdA\X"KX$,%%@UwuSNU\fwt%`K P&0O܆o w,+0Gx՟"W7P2 iEU(P6ϖGZfNnrfF&B a#F.\o!ʼz+tGC.ͬRm!bH_Cs`f'Tn8Vn6.11el͵GV+G]mׁJQY 3 YX(ԄrAX^"}>8wmg͢w,Sђá#c1AյmHlKY/CK: :oAS}7ZS}5aˇ|%-8Gz]3;:jm[m C|ȗ!_>˗JcN ܋ #F8G50*Co2`d7˩ˋmlH{`EYNkI1c@m8a5̳OF>.F>/FFgܘθYȷ ;1Ue3+i):+v뭰–rρ̝W#)NC}v.^& REȽl{.r0e6(ڼp5)V`{&~hF8R6,cCAR`C$s0+=`/8-'[Z3(p)b#-;*2d]8AaL}X=%ۑnVa@=3jg\Q1GujkgL,B^O >ֶ hp@~yZ|:^F}+Gg8I9J!*B5IGcڈEkqU:Uı' gTW- @u-uCRR ,Em[J%B.W*HIAH <̀|P5qBmM=GʈK.d5w:i(*;;t:Vע]J !l4|j/C@m\z^l'jI1 2-QnuejXY@S4 tmRR G@x[qm"Ȑ"Ul\;w4+?#v^נ\uK\TT%#z>U:Y]*N%v; ʫ7(s7f 8P[<VM+Px!15ugժ9Y@ >X j*j$@NjHSxZqP+] M-ڠk0"40Yl/T֞ZԆIϳpݢlV=;^cP}k蒳J8 `7&t 2:)BC1oAt5HSJ3p~C{ZJ(6ǛVU,5eZvRg7֖F[diAX6`&{j|VÛsysނ[%_Z+5o۰K5R~]o7-VGގc;Zޑîx'v=w=-Qޟ A>gU(zOl/ex&azM[6%w|/bf .#"^$"I$%ʖZ6UXh U,јelh*8劖(ZYT\ʶlR\ɶ,_$ne;E[q7#:PtWwEoћ b$1NjOŧ"{Jb٪j-KեuXV Fݤnk-objݪآWmAWB'SU;R V#_^sjPo:jTUԗN:Bivn{^l^ܹϻk]v]<]]<ٻwwwwyz9}>^IIi)7y{{0o7<M&8/yIvoW8#ngdy5ΉsQq*N99%8oUKvĥť9ť;22wB7:::8::: '`AC8=|L r>uMt qrBKB+ZgghO/\'< u? pG燷oOugWR]2{KV{d?QfC!?Ycd#--Oʋ)J?]ɟϔW_s5"yl/3e;JɎ^~q@O. @ʧ  A90H R吠j.A]rP?/G}rtTO ^oC促WrBj ׃`\4#E$1"gGE#"{|qOcDԄiԀj)Jò"׋z~QݡdIJlo1#r:גڊq%RlJ(s F:q>γJ8/ezޠ/[oldc9<=@:l,T 5HZttޢzmIRen>E[sԼқQz@2]WЖU&VFo.u?S?bJo*}-B]D_oqh)7v(gvRL[=j}jlޭj{P1)F 1Gފ:[gt$/ =..nː;됳KŧlM[L^rRM;9CZsЮG\y!&ނ;aE{n_|'a;U8y_Oe,RNǮ72~գ_C$|Gfص,Qq͠F&OãcܥFU=jϦ,85MgԸaH`yٔ_9emFPVk,]`-b}lGEctJψn>"w5o!3\kSAS2.c^Plf?H^CpS{,t>|uBɧI4җݛY|۽XneXX?Dͤ>W<&ga .ȋx=oadazpqN||F4Mti,'rA?_ IjihhVDDkD~~Bc?Qh?짡LH&|cEXQ,b(`(h(VXQ cEk=VB{ޫUfwz^ UY'/ëxC%aXNg=jlEX! ca?}O'fϖ9> 3gYfV9>[k,f3g2w3gőHHr$^YbYЛɏ0E6~ޡɣ *iJBQMnn[s=Lap]K m+(BY>ͫI^ZvQmڍ_C.C/+YLz)^V/}egJA;},WBG+CG)@SYMj55jj4* &A_9(ZGS'Y ۡ\js:9YKYt;[(luvRu)xg2VkZOzn>}: JRW+)RWڠ' W#u RUגRשSF$0-D[QMuU{՞;*S ruV柪+RnUwT=0[FzO1#e\CPм#eIFHAϤdzz8ƃrj~>D=|>ELV_@Ωj*K%\\j6ej9VQ ZN֨(kH&ܬPUmEvȼSe*BU]j$٭^T8SگbUZi t#G`8=p{#Ā# nЄ& 4}P_J0Bp&_) / |ɡ %kuTsquR o7#Vlf~~!hvAߋE> žݟ* @R"+DA8, D*@W AԠfPj}ݠ.;zAXpϷw) Y C%8Q>aMD|}4"W'[`-V.eg, }I-Yb/b_ž4}agmY[;3 ºbߝu9~q#C=E<0X"`"Sb_pCz!VjhG-[E{!@At.q7U-A\z(]Żd*y5D{ebk,E]G2nT7bŒ-YKu@߾K݅nPޣꄽA4e-.hUw˔zL=f ) Z_ģXєE4a-N R"R )n SHXS, :pMpmX5zKJt"]Z)n*ݔF|ZA7t[$k,Ubq-Zŵڡv Adn)b(&,=1Q< =zDZCP_O(T) #" JbJe3$A-vTvB|"@bd E,^TR$"n"1H R@c0rP=D`D-p0QbDň5.@J8Ʒ̦{/zMe/oz6]))kFYo"a=[y X/vuȬE׋ E+eۃb{/٩t;=ug]G+OޡqZVV_2Plʵs M;bwB1IJO۴Շrz'=W愈n bǜ&o+umGiO}HVnzaz4c>$^kМ <*"ܤAzp$/V$2І(g7inhɃD]mA0Fxdk[ɚ׆ӕEc>jsԳdѕű5 %Tb[9xj/cط>"q> L@L= >5;pW@@K^}s<{| mnEJ_聺m% ;VGC)T=:^in&&xQ+ʸ^~LnsNtـFoaWJ%#4Ǽ2J3i֍ύz^(<:ɾUĘ2bs=kǫ Rz v`|-ͳ-=ϕ*Eg˜~Y*S+O)7>b ѣי'#=!=?e+ 4 syF0Ȏ=S)Ț]DQ48L=-ό>Br.ROcȹbLZ:'rҞM&@xZ'6CJ]rvѣ vCbOB8DߠfPfN:<5k1z;fƣVVleG~T5%Ocq,E1GjᅰCgrzyiǞZ>VOn;*8}`1rb-GC4ڮbg1+6@^WY48#ZחT*0)FR(==f?mPҬ=i{m!=8Hd1z0EE"cvv9%o;zӑQazr|];0'NCowuOxk}z詓bL˟ʱ2ӽfQMnmDm;/0Ti]K.Y[{#ס*Pb^EP۴A{-xbo[ZE25 ZTzd1q`*}B;?b}༸"oۙCe1r Nky3hI|~;6ӼnSZʓ[,|{ĥFo J}wPQobb6@ylISAnNXj3<45G=5F9|މm̮}O &;/$x\sȧ/enZi@+;>6}ox"t/P}ezVky,Dj-{q\ҴCמ(GluXm{;_}ͯ{za3[Xt{GB0_o}V!gU,uuɗ1YɿTbϿ]A;kLˎ#?W@z},nczJXHOC&ꙧCb Qd~/5,;6 /U@zvjl=c~ ibq,(-y{;OdVEW8BOCYzJĴ|*!$Ry}m=xޗs-p"^k%mboJTѷ_bt!{F툣?Qmʒ~Z_;ns7jR}h-O8n=)G;{*#vM34k/ߑ(ESxz pi#ҵB~:1Ka.~աLgR /`}%Z/@E[ю%V|{RVaM) aw<㟇&X'7Mc/=z/=q㥇6^zX㥇5^zX?-b<㙇 7y3{xagæػ̻5t0Kb|Ɨi|Q޽^'>oxݽ|2u8Qz o73uQO4uƣᓍ/>_: Ki|iƗn|Ɨ*.-.2^twƋc+_h]+ Gx+H[43_rˍWqxq#nG?8EG 5p0G6p8G7pĻO8KG|ms?ˌ?i_lf#r7x7xۍ73#(I$ m<8<+q)98S1H`tMAj*US=OQ:<: 0]D1^ t--7qw{9:+_kNRez $EOP2VTuXK>V>6@JC֐F D,f& R- =bCFz֟lxUS36B@&aXmb1=6~KWl6`߱#Bo/hbgYmn=)OPM> \"r-5Ӱ\nqtO::/~!0k}+ u= ,RRR#& QUTK j#Ԧ@7 MgF%D+\m-Zc4qH1]n~[w =eyO >g3sF8#錥d-Jq&9)?6ڨ3PȌ' t[ɭDMH@gc$]B5ܥR e2rLr1B@JJR*wyjw5U6#zw7(&bnemqR%w͈ tv!w{ݽEbɩҡҕ.1Cң! dXIH_TE2 eDF@1VUF$2 Ue5J:8g %ka_[:ʺ'lD yϔg#ϒg/&<yϑ[S4d3=WK!3./-AJUl#ېp_7JSޅRO' eH>,'H|L$|O^')8<-g3OgL16rFR0BՑr$W%%Grz#`?VEgz('Jh$'!#TG?g3" s9_i)կ>W{?G94 HX.T?%s\JU2Ε20WJVUϕ^n& 45K<>J1 :DMULi*IP3\U]դ&m4 TCՈTg3:KlP)(f9W?} Eʬ*@dAfoMPDDlEAADdD@TT AeF1*:>:㨗A_Y,.w}S'"ND<S(- _,A/Ps3]]ЋPP (P (P (P (P (P (P (P$jB-@-RKZX)TZjA)P (PWE:9eDBBQm`A١ِs[64͠{]hQhZH[`B+C#hQX1P8_C_VXG9G-GBxKZ|qrixN\9 JZ9VNɩ9@Eh/ _U ~$y '䁜P uDskIW(MXDW  c˙oGH]**i`GJ}jj1Qȗe?:cs}륡=:ISaWt=U&δgbϒlgfAQs}zg {!$b%RYnW+!*Gj5J{N)'M##`?F{#l7))Чgނg(]/"8@@/ۻu^_oߠ^{/zgww@hDwD{{} ##iP9GjGn̕;">߇= B=>ܓX, o7Aۓ6õ bٞDAX('kk`֞DVU0kO46 A#=߇A/ Ġ1hX3a-c#EĚė%rk9 _"jH)eȲ2Id`mnO0DVRb`hҗQW.dԕ~RȨ+&fԕudԕBF]17BMCMP~3) VR_j DEbPu uC ]iBNP ,t*tF2*4 ӱB9zI{C0%4n CC%t+ƯbIƲ*PZZR %e!!t C]y =- =ڈVgz"<zTB߄? }']?\L+PNH?sG?"zЋN/4c$P3 _#dNz ^ ɧa—ssM.:)< tjx*;ye(#1N=}rk6sr^*sGΐK2ah)-K4/1.UC}z-9LD~=~= 34ooVy'4В~Bs Bsz M{{Q_ -er~/!M 'ԧАBkAAЇ@ЁBqxm!l I9B[z!t,8[礕ކσ6 PY :7on}[+{| 7xC8YW ' ŘG-G98*Q= KUFTQZ0 R=FA8jg*"R ;e1.Rd 1FG˘jg0FRH(B^EJjHI-YY$/(Q0vRH"R *R FPjJMAA *R#Q8J "r?#j 6+r4G|2GVYGVEV!15b<ڌԂ0St6Cgw!uF s;@aaJs1| J}HE; =҇ߪqFJ唫o9בNJ=zΙ(sܒZZJl9SO;.dEk_G(e>ISO>Kۙr^$AkҗHw3fH36(*g߅LtI6[Z\F:z I+HD:6ҹwGtrYO8FM[H>Otr3*uO]v] JCiG뤨NOҩYN?i7<ͼq$/>W>!]˶H<񟬧ͤO>ܳ>=G4ԍ/ƊA 6JSFt%u]/kAaU8:Xr1=҉d+H3t97JXм 3Io#g. YJ52t9ig=rg~#&͔3[J9H'g'.jTAgHIC:omHmAկxb$ZPx؃ՕPܔZ +ZCġu鸌+:!iE+2U&]*:2StrIg,Qэ2ZQtkF$ݥ(W~ vf$Ca(UA/>`TpW+r~йr¾xg:Ӝ88unsB.n.;` i,sKuǝU_9.-qݺNkM(,ˬ% 33/mE3)^ivW/On)1R:GRNoiƝ/u_x3 PVLuG}ASC}8ԸԸ57rϒվ*TMݓrfSIR};)/4^xԱofɋ}GZ#)ݽL]G; FY@J^?uXOU>ʞE v˝a FN'QN([שl|v/KcdvߜkmW!$Ruk%)%sv)efe>1NVvSqQ-tgիґSŴzvηLsF:cpsIN wnpf©UrK+8v L,=m7>6i>7Cf^v?P z @f cv`g(ٮ4[]RaG~ g#0607HkF5 èzA%V =(SyԬԀq8;@1U^3x%JGu|ߣ??II7> >B'~eZ-+t=G}vF>DPZkZF?u@_A$ce^h wA)]V]\ÿ+GP֟^7wla WiԬTC۬_+^c÷R"am9=(]|ET}w\5zZoVWӰ+}#iwiІ>W;XӰMr+U/ߊ}k8_k|mvkqlikuֈsO۠4\jLbv BЧSjhiCUv%Z ?geJNϤ02w\x5Fg+N5&T~V%=pR͉Y5{931);'7_ъx33dxUvSI7}v5Vdd Rkvp~IvN3gzsVe1ZUy,^g5ŋajORj-.^uqO9ŸbSN14oqyIYY78՞U 4n*CȬLJq7>gzRO>U)~AChަqqql\o\\0٘ 0ØϪFSU9ނE"k׉>zX^A36$6D_-,׺w;LntǸcd;νNnuos9o&5vHqO+UevFH{{^cNxO|Șmt,KL4 oHx"H巕ߦT~^W?~>G4BZX05+5/;Oūe:Jv Dٷ#MLMlէjr[I9iNCq/ʘԢE䵒I3AjTwճK2חHjYP?gճQ d_*W됔H+˕Δ.mJ߇ӉT7NUR}ZVͻzܒI%y3UTȮ,BRc:iҟ$\M=C_u$؈3ډ.XuZws7Zo5HJz؍} cb::!9nwuGG^}d&0b%DO_I&o+r̽MmZ \_8 pjR`vlѰ]+f, ):>:^& S F.]]2t]tC~RrbcAψU:sb#{l!b[$/l߈;uOĎm r_ˏ_%'>*>YwgQ|KAW1f ǟ? %NPǂ_%m[<?-EnKptuvw6n/ȽRR`/wGH{^^ww Nv>?nt7nv>$NEu︇%uI+01x~{^ ]:zw%UUN¦%^\8 tz\ WQ) O[¯aI/$~-QX+&^ݛ zu88ۉAIz0qT=K|Xr$>$tQ.:~j"F=0/d\SSӿXWPW.G-<>FꪽP#*,fLKߪnt|D}-rZZ|j U/q1=ek1#U^bv@bQUD,q6Ia(ׯ[5;&:+zueDԙhS@ԣџdٟ. L]:7_(rh&6L jô]6_O*JP>[EqfZg!,+s#O8f>BiNMU~ӥٗ?]Z\=+Y:|)t~O7_nO)O3Π eI}ȫ"P{cC 3/a0w08"LjX iI| R`@|Y|ƗǗ#"@3gW!/~$~oG.~ u+%W@5W5]k"o8ܠB[S0E"L|&_/aw0E>D؝΄4Qߺ&ǐ?GUchW(H<]r=<ؼD>䅐r{o{p7 0r7HЫ]h8+ʐ#ۉx }{w@{o{z*³gUϪb|b|b|b|b 1T>1T>1T>1T>6****{"œ_xOxg{$ Qwo]\ߤ6sH^L CXQ1Nu + ? /EQ6Vb~B ( *nlT):+/b6Vj9#6NĚ,JCoHb&,,H3xAi--S\!-SVK <,zmMlvOI{/JNxEO9b%:qw!u[J_'VdTfKk~DтïKggRޯew; A26w _._+C -|T*%-+Wp%rěȫih$M+a˵X8Za9f<:LR4NE5ӹ<Җ]f,&Zy륔~ .`/4 mہK:XCM6"n;K ';$װN7|&m[$K|'yJOjI] fҔX2 I<N抗$#H'%%cR+&],L&NvM*?U d$ph^zzQxfu+WfeV2gjrMtM; bΌ)V~>Q)NbZZI$&BX[ 98u~}DR a]x0%+O%XOg؟ Ug{ثBbU 2Ә9908j"5ZFi-2H "ôZN`LT.-ڥF̥]`a103F:#Pd6Z@F|h׮B}[~j ], BE' Ѝ/Jr¼ߠÖ GHcbra\.stFXգk!C3Y-!93HM?=Y\ k.U5yUYrlR-WǙu ;&>'_&ģx,dH%`yI#l&RTE H`S#.;4SߣI_[9W ;3Wث<llv}5yE(GK&ppj*Yy\Mդq5ԸA8.㲨WP=PQ%gEHn[a8ĸ {ni鰆1>B3b !q\!>s1B\C\x xX뺬껗{&3ٷou~UUݪUuDdj;Q(y2/G*"];7O?j+5UE7gxz|0g[?8!)GW\mfG #?.28_",D8>P Fy_-xF-w>).Vn4Lcq[ __cћa^3?gV9^ .2בu6_ՃaB#dЧB?$F RQx?QCRe꟪Jggr?# aUPUUT:>G[R=#IS\u^IY5MW&c?Wx$aV-Կki>1ޔܛf0hʠVd6S `J11e1]ؗc &BMBK1Y (h3:d4gѪ6NGRRiZ#ѣh6jӴǵ3׵t pd]n#aa92|X7uq1J.&׺H?(A* Nc@se62ae1LʞlH&AmPAg!ǐCR ņ d{(RL܉L2J&%àd(JF1d֠dP2ϠdQ2Ϣd2P2ϡd2Q2kQ2Y(u(l'$^j9r嶏Dg#rBRfsBgs;+zÿlkBÜrL‰Ɗ- z/Sdj]ͤ0)P& 2&0ɂxy<&4M&Bl&+ZUȈ|"[m,AA/'J;DLj$/bmRb.h[ţՒʄ 2Z=Ra w&%_&8 3h%JuNFs?h2[oF@opg?}Zsծ!m6?v%ϣ QCrfσ>m~lę¹BK~kpv >,'F|cҕČ,>| kyc} Xb//#r}")'W =N+G.k>ܬ^.Kmy>1a>9EV E$PbBVLpc I1x >,k (/a&JIW(5ۮ Ҳ|sl*rt0߆P:#sqL2W@;!ut9uC 0.M7A -S /MjgA۞ΑSI жW"SW&OU!OD6lYQ%R>ߊ*oQh_~;횮EIt*HWC2ǡq̏>HUUHu( ,m"\XMҾ ]Lr1pU Z\2@#(&?.*MFKX !md) Q|M20+Đ8|ʽ gYwEֳl#t良7;4L5 đ؄pJO/;[K\yQ+9tCy~r~AqSx03=a0NC_Ǚ~^Y/fԼYyE78ӿAA=.i&ɟk~=8hs$_H|g Q{AGȋڏi?FJ-Č3+Y7FmqeKDDNA.qh)?7zRS7595PW^uOWFP >^n AEt{u{IEB>n?١kӵ⚀] ~~+F!{3kkɗq@c<' _տ5Uo%_z/Z_MӤCY}ϓYA\,Q sakVYAy9  p/^3waybZZITU`-C(=ޥq$`C[AN~ )'*5P.},7GYRe1_D b~} s|NҖd{>^+VABS]Ƅ|~[¶lo_wՏ#42x84SJY9v3vgX'rҡS‹Z OFM1lë1޸zJ)[dn|?b,OOtQԔ9%rgTӻ(N0J/SlqlcZuj-cO()>()>k0T2!νUO;UOIT}O8߇2UOiT>lT 1cx?*' G~%]y4)HtEt}"]!hS?k#Vġnrӡ{'><ϻtiA}*}~"Άx1ʮGy#nT2.FP~{ T֏8Eޗ_1r,EЇb8> y D If#"%x=wO$ u{b Z'i{B։wOWw=^/cz*U(A,@$bQ(82D,J"%BIyBefeG f4` 5{Ɗzݿ=ZtMC gBؿvzQMa]\?`O=tE K|gascQšaؘ4Q7)-eȟP#tBC)jU1HB0 #˜0.LWIaJ#91NLSD.f\1_,KD(N#:q(-~!vē)8(GExM!YHRH)CZ'm6J"T̗8\JAi]!햚}Rۓp;$R+KgatA$]wma@ CCʞ`OkiJy#KQvl{,{^,nYnJ,DDH^ooTɾ){G2CdGc”,1}N_R\7OwCQVĝbWlxBl͈=b8 G1C 8)Nwō9)NJ)]~#*Hb/rm3&R!&Yq$)IH t~\ bĚ)R~ft8U# B`lCp ~8 ! )4 n*s~]8 q+  C5b=5 w퇞R;%NQcA~?OW¹Z_%)~6REo I&w]WүU7'4 . }|?wn9_oz6?pA%$p!Y iB& d-ex`m ~$˵qhZif>^%gB0-[yI ;|ÐEF~04_DC!9l!)>ٲ14ls9|żlSL|o:`Ϸ#(zl>~i^3>nrǖ; s,77ed܃dMخMXOڲl |-a*umF.ecom~Asxc֓SAY<\^^ހwfu6bf6ڒleֱ~AFs\n+q6:hs!ořJm^3>/-yIZ9ęZ:KNSk8W&p\oo)Ƹq1n}Unh_y[pGr"8sq^cr^nffn2fr ws\/ϝQ!n;]0.+-%r<%& !vp;cuCʽͪۚ{ ք+\|h|fKNهK9-%XL.ۘRznbW̙8[iܜ_q\D˵rJN!G \ہ|X ܹp}pyw-wɮRF^$Gz۳c!K;R`);^a's:{|1basD.q\y6v+W\98ޔ{ci#WB,ysppNYbM$M2'Xc7MlK_T%X拖cVv;6Jٱޒgd%m+Ľ8) = XnpȽ=ܑ7oa83$;NK>n0dciDzh_mc6;ɛkzw_ZJ)ɒKYXW_>oƧ S-6mzHRTq䀤 >,A9ߖr,ہv~wGڶ}[|`-}@mqrI*!? %׍Kw9KXd,5rFB"0l6l3 =Ф2%MZS1Ӕm1 M&B@zNSitn:b:j:c0 Әi4aj21͘qD?)s@Yt=F0 8(tt: 1i,ra5_mF[0Ut|#%X 0ld)Z88KQ ]/`вpenKsY,,-]nKr2 HSB.X.^A!-7--ӖbĂ?dUljAOF&?-`Ya:(f؝MS;(7dkvhe(E]O-8 0Zj眜 pu6F]{Aww^5ȝFE2wrYX)?@8u ֍_M"yE"júٺ^f=d=lv[{3siuMm>Cʖ`KimiL[6bb`d:ln@-XokW5Zml#=>m6}ǀc1s Ҭc1xB쥎\Y\YBe)ee²2KHN@euDe]Rzٞe;::J);~֑Vvl2]vl|Ųaxݲ{eN⌧ṃ\, c.4::;w98w;L96!.yw㠳췔:8-t$rs^p^ [9o:o;8}C./drmyZy<<0@ncŴ~MrZynG1C|N(=+ΕJ]:W0M[ԕZos]%. W\\d.W q:\c)iq5:uw]4q]v]c\7\\w]\""|0TdTPbS0\TV+Vl!++UU8EfEWފ~Z g*命\KWWܬ]1]q[Np'4w;۝s&pe֜dIR!wa^ot4q7OҶnlwpGG'=>{Rcq p_uOw?~`sqF22ŔSL̪}2KiRtVz,:mlq=-+Vv&*;+U(Cu!bIZZ{RGj#bznDEǂ=׭SB%LP^\QY^LT>e>]=gGZDbE]U58{ F-yćnYy@| 1` :yl@܈S"ջ_0WFjYtFM}0mP]e%@!k3a[Z\BRJzfv`:p?FUP\Iɬ6ɩɣqj 7kkL֮[] 4i[ZsH~њ5=5}55C5#5c񚉚55S5wjfj%5s`b0%cz:m`INP:` XGG`w  v;ǂ'l--P[fm-Mtd65V^mF: mt7njKkZ?!-FFE; rѱxqQdӊDgΎ΋]}8XW[;F?<:yox.fǚZZrcb]c=bbbbc5beX$'ƦݭqFKcKcOĖV^mm}8v8v4vBhvWn[~x.ݪ/SꫫY]tzB VB]WC]'UO"ӫgU[zQuM'^17Vo9Uzo{յ՟ZT}Xdzxx~{im@xi|l||<1>9>->3>;>/~_|Ic+k/_o??<~<^-N^~#K N OeD$LLLLsOHJ}:>&%U-ҭӹN^~!%2oןJG(%='=tfI1Iŷf'KO^.{*&!r/7{Xz[z=}E37DJC鏽]ph?#_׶1R8LqRFi(tLWai6Wg-̖,\:1S-Nfguռ@k>d>XC3عV8U٤gG!kϺGZ;kk!\cj&lCe*QgR5^~YjzKVo6w8Kgct5F(1Fk$F7c1Xb`4jόWƣix99Sg<:nccQ{8w5@v#L-vǚY nuc${;ݼН7/u5#0ii3pltw;̟;ݽ$wϼ7p~brw_G1ΜS̅VsG|m|z+}WF;C_~m5-XgYMV{߫Vm^+k?߿*qFG냬Y'PSwS>i^&l.<2C~CYPNC(?=T0Wo04pǡa@4464>/ڳm>C{w M  ZҳmC #~B[}Q,m-uYeɺ" ~ǔ26V2͕s:srkzazeV̽^||_ϚTYk~ggz3R,2TSZVsjkZvV[ʱγryVWuU[Uh*IF^uihGUQs77#`$ N NA9=^p'ſp8?'sSPP+9cg;  /s~%'|EOMh{<唏YM]NBS)Ovh͛5GvTȾY# /T+M[}( A~oՏǧ.ҏ_fP?gj֦,5Z?grUZ(YއsT\?f5YnST5C?BuZꧽz\itT+I6'O6k駫{j-ꧻ~.TOB~\}.QuiO2i8K{˵glkϘ FGu謮ў}e@ ҾB 6*qZc1^]gČgB0FZ77bc wwUsU cc,0JAAU:uXFc[U'7llW 7}DWwwS7{{K^^f??5_/T_G[7aXݮ~=z*P8b:uIS3iNԘ@,L L L XX , <XX:m l l  |8884`V0;v ӂ3uyǂ>|J+k/_;9kwڻ`yX{>c]?ݰ`ݱE%|OlyS1lVb}~Ə;X{!~%>@[{ʸ޸^]_a烵ߩ3j1W0:|qqbڟbV^blv^j0vQQ_P?!ߛ˕*^:^im?wG}:}y-ux$ɳxo{aN;%7c:eI޽9Iwf$a@Tܚɝ9ISt[5$:ZnvH,7j9O&gԂ-'Jܱqx%C&I4OI޺I}~;-m7MުM)7 I |-5?$5 ?Lo&1D M^{&đ&qD$wMt\4uM}(R`d)IP}kĨZ2j#-vsm7bfBBnw-^O.,ȥK}j&hXҭ<ܠݥUu@![ua5)aMɬ"r+-wr#0c'c/wrC-r; /$뵬Mit^Jq-I~o>UXcL vԸFJjXMȆu2F':(k}z==1$Vֹ$7bhh{fʻ}ݶ;g>yy+2 <"3r"+~[0G^oߝ[ߙW anQeG(lPzɽYEٸXYڻ/%rt;}UMdd~7GFɤ?-{2sKI'Jn!CGw%/(c\l;+5'eG/>Ke/$~=1;s;OhV_]4eC@Yˇɷ R/_4$sFAg('~%?&>T|@5/6Kdby'8(-r5uA,1RuS_2%)}8<31Nl~H,(5tM㺆$\CnLSlV^$jI̕giY)+y2:i[vE3~HE'Ub̼j$-IpW$_Toj|SDWoYD267ΤM9I^'sȘ98D6LLjz^:f3f֘{g&4$)DN@HḙֲTٵGe~]rxeH#vWUVIes)2k9ۑʥ|-R\M"w= "{ WƼ|R^Uե[U}W]->j?)_GIUG$wUSWͪWlW%tՂEbb U5G ѣ櫬Y /ݿv14y^Z8>8wA =ߟvΛpI8UpxF|h~ۚq=<z,z_<- }rǓ_88P۝u;)i>Z&w R #u3"WWd'~D+M?>#u1_4@fYj= Y_!Mzj3j:v:v"ap~LPX d-rZ#lӭ,V"2-YlXxl뷂`c5lHxT ljk=[Z=>QE|ez+)fu3+Zعl o0.#8j7"f0xbVj,bHo Z^NVQ0;X ZWs^D6ve[ &b(2EU=УQ=*jSuUUH e󡦟ԴR*5[JaK3(nkx*sǑzvԶLi2YV]zEZVF7js-#oOb-f$oOOs2G{ :AqA} dn B5h Ԡ,4P=?jdkZsajv%->NҢT8h8w=9Su^Кz!s6s NǡmE66 _<-dv/g>vqfgjCZٽݠA7n]] F3Z_ Vt8pBx͐AC !;IMwj{ $OxƛhMG5 t9t9xh#'5{=v4cI#33|͞_$`wb,([D֔w}^)4KNc8^/Qc4-;zG_d3~d֯KivzZ|4w897 46vfC]I-AK˨',}Դ7Fd'&P&f4 t3rrRMKМTi+AsBN-"{!2uso}Zk%~֥v5=ԡOAc-֒ynSjN<OizY.@W^wR>ϥ+}/Т7C)ΡŶg$;{q]w󖦋Q9Oh {E#UdBM˜>!ӯ]v_Z5z+B>E Xi;߽ڡ5{ܾQs =2܍ .轘 BKYg{cr& hѮ sMmuUhAM? ,)Sл;4Yzbm4>OТQ/[G"̓,g~]ۏ'/VIg~;_v(ǡ}Np/)i5-KP!Y4 }ɢeҮq&4-.EOS4 zTJ0 d#oI_xcA;Щofv\%cfbL_bLsOdȓ^=<P6{j(SOz(Bh2h28ۇI̯0Bӣ=EZr~%o4ok=X]v$oc/ss%OX`Gǚ{jN 鍞o@*B= L䡙 i1ϰ]ǨuIAgG3س˹Cq#k=.h;Fs33Nd;Rm7 )ɹ;?&3Z[_PAYuӾ꽼 z5>KfA{=މHբw"Zm o䭛Mټf~1yt?m)x]C)n^  |X)H~[;RFp)׺Ex Jgwv"-&&,%J|12q[H1 K4+SVUΕ>hXEC-5,]ӊe샖x46]m-4vﴄAw.{+}_Pgu mc!WkəÌK[i~3A#SWfg-xFК/xXuAf{ٽ ZE6^&z+8O;nn=20Kf%ٛܺN2"F^"-iAM̭"Eዄ󰠦%j:/n-±GH#א? ~ K,qg?=ZH/ysa] VZ˾{5gbCgsxwDELPr(;{$UIX˪wwy 4x:K COo>/hQfj؋v65<)ht(1յ Eٜ-_%9GtH2 e"y/u 9uyķ_5!,xdLVzR6yt8zK=:8Mb铂  rN?=c}k2Dhs/Pft jZf^I[tb݆fv'8b/O؝-!TZ]WD݂:zGvUEzG#YOhX!{%-B ;bF8{?O['{q8p"r?h?$:0+r R<Q;&"Utg}ɤK96qB8;;oCE aDD~>{%"FÉ}aPs@n?d L܉w>G͙wNԒh4Q-hnad!s'ۃ|NgN>q0NA9;f)ͻ! wvi)4^w] c`uE̎+{k̥鴘~x7R! d+BN(UIﭜH] Z|Zt m#m`Gq!×87vpEZqV!L=i7qbȶޙ<=Kypᵴ W^@TR6IRp)s |Q Db1a5?78/'gгm$yV58-{wk3H 1 QbQ0 3wFJ|CC1XcRj>Yk%>cRRkj 5ZK}~Ĵv{:w}>{ga#`?Þ{+b'aOz6)oK5DNCa+  ȡ*bQt/E Ѕ<6Q ]4w/ *$=Mrڍi;ѣNzBlD8x'yz!LqOAB*" t#xG.;d'K/J$c3c\ISlP)4}7_b9O968G9 QDo#?}=}-sw:בU4g]ϰ) `ce5mtbfA\%ĴoBcN7nGȬCL#Fis?O \h Y[Y0ooӆH>C7/ \Clh@*B/ߟֆ7h`=;yYgxuUzῶلE0k j׻fS~aUw>Sh3a V9|}Dߏ'&@NNxV b_@;dڏLw>_︌Ez~RNCX㫈_iOF7=<wg?Um>khZJsina}62Ϛ9;"4kIC?N$=?CQ-\ Vz oy󷲅.Vbǂ.8/S1SnhIKͭElhJy4'U\H$ଇ!cB_N/cиkz_[x.< PJѻۍH;kzwIoki"zz>mB)< gѯ8W?v~wObF: a/ó짰|̵dϒ;@.OĞkhW+N{7A/W駈܀7޹^3A}h9O@~?#=~B?j^ľo7!&]X#[W1wH~2}c-Qϟ,pߥ6p/?y?ZBf1$K'y.V!߉'0 9z<)ׄ 49Uj[&a yEH.ـ|#rgan ϟ 5>R[@ %$o 3^#CϬߜ9y NQ[IFZ~O |]|'}B3.$Cr NR|?z&^7<ƅz(䣝#vUV/Fs߄{Opnhm^/14JŸ<] p~ͯ] _:L1_wG=pou$O_8qw9h\{+xo ݜ#wwBNFTpRIapaqJC{6и[}6hɳN]~@ `ОhTFpC"pAgtKgC=hIZpsڊסuI*tRC<ܝZr@84 oCېL%u}A>J}4fA,(+8 l&o~ g [ k_?4HICvf- W@w}9C<32!s /⋠_ _K~| | e?{п&M|20A @'Nv`?8(U/`Ջ?F?v9}3 "4V*4_] :OBI ! !32#AcЃ> 'IXq^g}o>h؃P2Lw:a^ضe(+Ub ~ `ƿ/:6,X8XS^gMH 诀H63{..A3Nڇ0Vs1VsAß?96$̵o>>:1&^CCۡg&$'!dɧy;}QP6I _Ty߄7QjJyv%eˡXebKX {{~ QOG]PԵmXEւFC".2ЈD't?GX"~2p2p2vdmA]+* 5Y;Xq>2[@C{UDx8O_٨1|A¨JΨ.H>|Ym6 z@}eF٧AC^p}ψg\ :hGE:诃n =M)`$xu]"=! 34&}~4 {16l#? .m6 zc "|}CC̓(,QU{a^ߋooK2hqwwc^$̋y2lEDtJN .b x#Wx_Wg;l%9q@򈓽נ5W"P):ـ (K% DƘ( o,X"VzeNxE!1Iw{ _y"qQF$"v} ưcX^Wו0Y%؞0΂3X|!‡чQD]"#IN|N_4|{iNp<%9SDTJcXb,7V5zcFNcM !㈛'SYǸh\6f94\3,4Ie lfjZsYg.2+z\kn jn"g4GSyQS) w㔆8! 4܃S㔆lp/Ni4qJC.Nix4LdGQ:)M) SpJÃ8!P~~Ê;B8AY *j(Y 8c8 g5{2=l'˓*pVC%jg58Y jg5D=/y>æy>,Y ଆ8aNiUϿkc~J,PSfK+R3{R+^zS:̞z߰+S/R+lX7ct}><}X_&}RYow譔vCԻn yWQ~>sC2Rz^?ox$<@4ɵ4mHY[D32[֓D3q K Y[a18cYd[>d/qH#Fmb6a鰉;"%;$+ `8n , |߃yͦyebF]rO9s]SSd>t=#ܡsܔ!B RnUO'}>KL %nZJWiF O[mN}Cʏt i}>OR$A^}#,ؕ>f%l6ݷ[Hn>rT"jN4%ЗDӣqќh^^p}4=`4ZZ@ icfDgڸGӣs7!\r~tatItnES} h:|[&>5t^8dapP8^) JSԶE*\UZSZAiVx=9( Ӎ'1'/b|y[r+\R~1o,#rOr#Tn6FVnvSIM!8␋#7c7)g =7.:3>JH#&dلܛ@ЅB( `C߀B 0Pw,7zB` .6$"$8⨋$4 pp&pr.] a 5 L$L>zM ?LlwXpcہńe7%צeֹffBKB]^[o{oE&q?=^B O iR|wu}e܏!b_?m$q^펑1fcm'_2r*mȫޮ"*U}=˜%,|BJǷ"66V:8-49z ^?ks7>>i urt{osӮӰ9O 댫C!_|6i3i3i3\ 8p ߗO=Cu{l0|}pnߙ4^3ۥi||fSqWߴukV;ˤ:MϜ뮋:Ef皆ֈ_A-9o.u8XYo&&&alnp}IkgL7q$k{D_?#!d]w G۝96w947[>Y&&':vext giG&{t%ϙW\\((5&ˍ,`txȏr=qE5mp?<0溠b +[_q|3>7:cfn&l8%`XL7Gb_뺽l[vИזUGB?a1U"N]j:!0.ᚓ9P@J  WPE,|B’r*jzW~#a aa'a7a/,pppH3G59F2kuP>S~|y~>a=tUj :¢+oPOhۮ|ήhkў|0l lr\;Kom-ẏp}KIV(eL۔%hJb(1e2SޮV) 2e@IY4+eҪQ+J t)|F9*}@2Jjbyf5O-PCjZZj:CiWgsBu\]VרՍuҧTw{!zL=RϪ=EehZ6ZԲ\-( k6P\Nni 7SjThk_ &m+vim>8=N%ϻy\aOL/0% ,E#ɛ.30Fqx&Qׄt1,"sN2M?JugTb_ }ul[¶nǓY߫c%Oq$h.] 4G0ݥ539{镮gzr.s{ݜup?h5 '&"]x ŴHYWC+v}[d &3LOOay?’1L?)n"s,˿__l?_^/æЯf7[.O>(앏'@*{O"γgx><KKx)60iD_}q?{p^L6<])ϖ n+I^'7˛y*r)w+"))J@IW2qJ(!TP,JR(ʒteJYQ+-6e[KrD9PN)g'rY2էih5SVs|B-TL Z֨B\N]DfRWjV S7oU?GݥzX=WO%szE ki~m6F&mDmԴZfh1mz|>0ӽli 8j˴Z}mwYkvh=lܵ=~]v֥uwv^~mD*I@IzI`pk?xWS\KIAIH+)%Lz;0x<8+uBm>0uO3:Rc5ixNk3,=*vg>P 4VhՌ l oZumo ~+4G)ˊGCRbFq93ӰA*W $O,\9D( o+JgڃgY9vy~C^(/!,'jZ^#3E{-mE{G^M,(<]4 ))DN;QgC]r|p9U * TR/)LB6QJ~豭{F+)ajPuu*s:"ӹBW kP@٤l%l'jWQgfF)QqN*s%ֆzµPo“T\x243ԧ(0*jK]rfm*x宷៴F–ڠM۩vmszh vL;qNv; .j W,acԒTRm$SSYx0n%لܸ  aB(Jq,KqPýܒŹVPRWdiɢ%+B-JaI}IXZ>=o !HQG,) 6"Jc~,PF ;T7f (&'TjǦֆ66=:5=+W::ӡs9׍i2B<>t-,ɲsyT(w|CAd gT fVTĞy nTql {`'}nv 3ajMe L=07h/ރm(v ;Qv``;'g,o˯fl Q Ct- VmWZ8mol;Ҋ:'h (S`Fz/<@ԝ}|ggfI1M9DD~I("7""rhJR)E)"rhAD."1RD)"r""H9HH1}>C{Ͻ?㷞߬eyLݝ_ۃЉCA!t(p;υ.9mՇ7E ]Zse/5 QKp\:BlZx:)xGS675Hyݔuy3|tjj;M7AjCߺoo}羅ZvI' eE*/lU;)L֊*uOvX-Bׅ፰7u? ʙہ/fMoy7S7JwH:\o6-Y#[7~(8OOOg^_!*ZV.~IS kS˞%) "kBI{V/J!px#g18oWM4f~k$\-X'iIQ7zM^nz$w;)קWD;|=&aoˉCc~?' jS3D?۟+["X.iGIRWk7[o~ '8(8^+wVLk0T% HN~_JtL J 뤠J0,1щZjbBbrb*LHO,/T%JU \oMl2v%CD?q4:lK- /^w}JKD_*H)^:R0F0t`bi` $b`q27 V+X$h+-+8@xXt'XzNpQp2tcY~YaYWAAoA~Y?@A\tPA ec㹞T6Ee34f+[(XR\JekD^IEMltr9EN-rFm3j 7eP Ww/ #?Aއ?_%.- ˧J8Ur}ssp``@VI ˷J]K|OCG'O` "VQ ( bA/A_ ( Q*H|H s [p`*+VWlhT݄{DTqXRA*Cp``LɊW'+ڒK2_P(p*]}=]+qA #IJ$'%NOH ÎXx rJzma%> GDžOM&$3ߘ-!i*˧V*; ʞ}W0숪[ FGWVN\9UܼE9qbQ },_bC"Q͂\oWU&_(O eR׉ X U$n 75 U"[!႑1OLNK5H8+5\uq <եxu~?pLC}Ks\)9' SR%l7vթ|87^XjXvB {~Lz(acC($"q3Rҳv^.XrzoltkRWA5 : :< z td*3,3B0ZP+k~#|>Eftf7&BVurjsW93LHd2kEA+zN;.g:\W'k`f sk|~8Q\\\U_@P-Μo攤їfS!>;.;QkJ ,\S,..|I~!E_˯Ř58uoc.ӻL.vyԲ>֭r̒Y$bDh&yW+yRջ1MiW2zX;%,_z}5WXi)]~kZ+4_g(l[B{V֭koFE.a^JsYg[h8pio,/E?<,B^p?@;B"*#;IwIY2ϩQ9A3kn!@8bŸ#v@ _I7З? IJ%); ~^dT-ANBh`<-gZd٫5٫@}0Rf}J}&2r?|YUŜD`hCv )٫L|c%,Osrg'2YRҾώ#Z<44-1rc;-D*}u{ǵL [U*c̺d4̩'"2V+Z{u1ĬՑiۥ76$ed"%8<| "Eޓ=C{Cf;L?^Oz4M_o$}ORB-"0ޥko%uw!!]&Lnbf6wf'=ce֠ʹ~guFeb:> .,,%- ^]B.-ؙ7YOx` }<6b~U/E2gbQwciIƧcb<%kI评>J%ʷEb#9zÈ-z1D'!oH1_!A b? |߇0=a201 Œ Ɵi; "J[K x0>)7 "@& c"12~%G K""3x0!Wx0> x|0Bn0^h0_b0^y\0US0{6oVY`< >? n=ORx10K&7J`O}2`ƛ@Gw@5|x`0^BXmk-SCc-ozۏVҏtccXmc{}X7vYƖofo 67{6xo+ƾlolڇ{S+l^Tol.}hآgo1Cڼ3Oƪ'o,zZ73Zd&9nqQ9owp#UFgGW§JWG6tշgAרJivxs3Mºe( +xְUKm3Ȥi |^C릐WH{/Q[LogI3.s,I_JzUKq=Ɉ,4H}T8wIFYIAkK;A3h4kȻcCV~2ux}ic:bҙ  cѬEs!~No5Jx{TVK+;/> 3Aw[{ d.%H羈/HmZ"A>KA_9u/мh Fw͏Kh5PAlzmW`Mɻqt4|g>N.3Ti#%$^C.Z;<yf46o(仐om7G%:[؋|s/| g/#߂4ZS?3×oGCؿENfu?Y.4O"͗f{4{t6!F2l[0j_KxYF=oҬ] $4 ƨBϷ-Y*ߊ5k3)~!@%$%;ܦYG|䢇!R9i1roS_ +\Nvuf9;{9yFE751b,,m޶拌YPټ}Acf+*bz"%0-rQ䊓g34ʺr]N,mqpu]L.j LӇ拶=إm@T{G(1r}/\|pJaó/^wdVkF: ̽æ3]޶9vTgkƚ1=1`9bvWH20w?6Ʈ=$SUhY1کC}>!M&G9<v逓L;+pf {9Sw!9OsBReA;ǩ2\ƀ';3gVG; @&lDSn?BNF?.Tb[+x7oCZy8н\_SdHVq~ߛ։qGI#~bAcߠ\y|M>/O9HF~O|go7]# E]4MW;;ܡs-y4 g0O*s_BND6&Fl4Eo uN_A_f,r= gy7=SN]hmw GFup+F!Q~~vx>܂-^@CJx'觠ގȹ" /ʣWU"?0>j-~uտfYF26c(A|/eϽvrNh^&M L4H 4hIczm"ԿWlbc\k^ۤ\%R28*MSϮhUb?oBnH$OؘyhT&&s)MQ%$e5ΟIgo Oy~%ŒǴfG5Lר}qRWO\^әYdIO,)w8WB:]9;iܔ-fFnUwKU!V;@J9:ߪo][cGԏj{:[kXZ[l4'w$w {' '֜<˒WmƶZeW; VF or``قy\xhvM&+ v ZBOpPpDp\S g|I jʭ<$0ւaԠ/0R#دłmOA0쟪~+v fzz^m(+/d j$#(#||2SR0H63]gv-L]+^<jփ Ek܇B]h_0EFM"}#ㄭ3v%XT^65>)Y. (Cfg =IGJRU)*_#iEfɵdJB-+I{W f6KU]KEK ?nˎLIkøgG%QɧגNgz}M~ uAQvXX^K22w)̔t\+H U*iK%^N&B[J.&]'ٔ%\o\JQД,K7q;[+XN˖tArs},[%仮KUeGgkSѢS5cTUsB]mv`iv\lon%1.GS ˄ߘBWoPӰ@PTU,׽V zUVa)7c &VUMK̎j̒~Z5pfNHm_b2A#|sja R޺0[vvVÎ8v IiUWmNu~uGu~@uoAqAԊrA&z5CգcL ᗹl &V 2֤WK$?i $[u&_=JšjяL !~a\5LfSt k2$~`leU\OΫgT,,,^_I0[0OPD\R`ToY"W}HV՗ !NC:>hMnv{r}.+mϝ׬{(~-|kJXyuwk>õS\lw^,HEw%+hqnYr|ߒ_NwH4 o}7uݫޠi6ߔn-fFnUw]t-hwoՏ#n'xʚkv]d%vj'yR{i8Nw33wzgYt9mngs9u.9mXsGodP<2$2"2621252#27(<:!%#'r0r,r*r>rŵNnWߍ)w;Nv]nr]>{=^tEha8':0ZDD'DDs ˢMіhk\r4[ wN+bk=$=!/=+v-OYCH.q饼aW$Z{fh)tZ듻MY aJZo_O6қ-7ԫ'x:i$ԯ uXo7ګeD,r/ 6RrKV+'}Z0ɫqR7 )6WmV3%V/ce–UZBjoۄۄmK~mw}ٟA8^{[3?-?K:zŽcPcOI޳:i}X_#);)xɻ^buZX-z;'Lk5Voڇ$)a osgyBjuZ^CX)o :ɫ,^OIaaWĸrV"&9|lbM®%,){6}o|-׼~%MtJt +H%ºZΉWW y +~Ӽq7K5VFMW%rt&z$z̲ɸDDP~~/A ;&؃d]a^C>ogۢuNxk Zgɚ^-]QZ핝7W{/{QqG87΍9x oHHfg7T2R33E%3333355*33R3SR!33#K;w5T}_fڗٳg R\B}o'㜩Rs&x)H)q\.[uJXrRrzdOG Kddcr$=Дa,YO#ǔt=ƕ%B 4{'H1>6 GW9C!>hSӦ$_lf][؀Wʀyo-^ \o=_g ?o~>xw-h_]8{ &|uh"څG͎jNirt i.~33?ڽ꿧@]pb$Ӗa֩)EǼ4J sk&=$Mc-v&IJ`бpC3 )fe`v݆Aibx a S /xëkxݰ=,Sb8k8~0\cQdA na6ͺe=b88eggnjLvu,vqq;62?4~46~ϰ Ƌ,xx bw[mlP=w ޟ w lhxqlT1Sf3KٸgYaڼڬh#CfZ`] "[:Vl?;Ď̮ذ%g"9ć\ׁ1b׏ |K/qERn%Wέ*-;*!.pW\ x Te |<ؾB_"J /|i`Ƀ2!q`f% ח 3 E_Y"duCޠR2|}{| Tg'ӛ&='NMyARkCHC;S( WK(NMDmPHVMrJN *j9] JyoKAQ]e'^ZƫLB,1u?s(c'!R/7#m{^ ?} Mn3yXq0;ONN,^\Ag&&&>q#[὏`CJ9br!uCSzb@(F|ںۺqAS>1A8 1 uāt7x 1!9F*pdG.ӹpkm· ߓO) ӄ%BO8)ԉ$f2qx@6DNS}r{.woc#.rW6J.`c^r+.38460c7qpTY[_&X JS3X<ߺȺԺ"u -J!Qw/@TwZg1@FL6a_$ )J21AKvx.RĂT)KN0:Ka K,T]ʂGZI,L!d*2JneIXFY"[X[EIr3Tf;UNӘMNhܓ9r&sʃ{#uF~8A"a2d8س-O^ir ;WASnSc=b0v qaC̝ s94y؇RH3'A4Iؼ̼ Bj Zoryyy\ Oyt*7c ם )qwǟ쫻I=WVcǓVcw#A;dzP؈3q2@5"eF$ I>nE85"ۯ fPT@25CP)DuIhd~|jᛔ[=I`%ܑzY摅lQ{jH$}+/DL z gRI2dAXh0`^A ׀E *,'udj/,Y'5L^1PpNdy$bdiO3DC]`@KԀêXW4'$ph(>Ԓx<~&<kФX+Aͪ=z{hf:^J-Ľ xq OCB4`~'|Ik>'_y B+!ZU5iתUߍRi|FRP*E$b,!$0iΫ., g[7ǧíZAo{GpG*EDxb̤fGhB*˽^*lAɪ@.j!h}*] M]=1= a6zJ݃mEcmܕw3PRqO 1- %zXUf:QO m ܣP|oЎgA3 "qs][,gCpq>-AypBV2+KAcDXt;1pwc,1 FBWr(ڃ(LX0F~@D}'AK؛Pl]0u{މװrȮ#;v4^ET(qߋj,]Ђsب^ ֠OppUk1{\dE\%k^3qzj!K^vW'U(œ(Zh ]z~긫3SGfA8ꗒޛєtP\/q@wcWoRB"ľZ 0ŋ"U@t<юXA; Is\pbܨc(^}Z!xO#=BwZxtOB^9q}cX(e'ѪF>kq?OKϫ\@|\GT8puaW1>&q91U qo9o?еE] lK*D\jl*[e&DQp}Gr% \m<㸿1e\Xo!\,~ 9꿛JiBHɲ-1Yx}!U8X>*z:ꙃIm:Ѳ8dD،Ia~~a];w=Σ{G/$@Ų  " }9U؂{4cĽ8N;M_N181bq] sWѮe/#lHgQ*z}. rɽWG-𰹅d_X0Sg&>Aת$YEv_=b:D_ۭ:r?C(VŜBgS\̣Φ` .%΢`F\hV+m 5ܿ'ć^:jq3jZuuu&HiwD:vuBpR _۟\Cu ]B;'_֓q>n wUHyw$ڡt{n»t7W/,%lEq_7ʖE8D=>l z șMcWgh%]\qwq>> = D@Y zg#l~:oLTFz} ODpW#^_@ fN.뎾 =~D -_d3Z؟Z6YZL9N9o X%Pl yRָQ^6L6@j9YEbʙ< t"C |5Et%0}(|LwGa#^/'9P ;NsוzʏQnD>#$rFW=jnM r>L9Hs!Ճ{(A;z7ޠs?cF?nB6Կ,L1ͣPJʶcAp4݆<o$Ȏ_ie pa)RY[cC:'{ ~VG랡sRj,+H@B9_k7hӱmPϣFϑ`QM|] xLhk>`Cz~;(5]Ov/2llgxU1뇾~z P8tqyaՉ#yq{p\hnn "ePC'/ k9I؁R(5ȓE)㓢ݶBK yQPٟ)t_k2X~ǖQOXQ.FB_i8ĺ&| wh-⋿McuT6Sָ 舽pAtz;: =oE8u0wxm0Ș<=oR hn"0FxKg_CQBw$Yx$q\:0ڶ>$P%w<ߍ9K4~,:ů(9?%ٞj;>FZd9,cI~J, ew ~ìD_oo_nY+F幓eh2kiwNr$Qĵvb@)|FL!CJ㖢;~y0K: E{v#T3}!ag,dN!p_ȓM2Ww4`IcGRK9{tL(Z1-|s2.Nu#}]g1jƣw469jj1_5vE~)yJ{~M420h?Z&s O6Yl~{Mv^7A]tnRJzeF6u[Y8&꾃;hf?t,~W=q!g-/|&(_12"sRZ缭k?yul6뵶*xtU9cZV}u$FYVu~⟼RN5C[qa6omF[2;DYat*'8bϓ~WݦVj.f};W^իG~IIq ;hBbhM,X4%$6%͍ O!e{Gn!"\ɵYڪm~al| j68<ǎ^2cKB/WSd_Rd#x$&xsh^\]ַ_g.R=މ~|G7|#uϳ(Qm#Gu_a}?{jcKq[?Iv>1O5;8{fϚ⚟^)xf̗eOy21+' ~G]qs6~n/ ?3`B^ _dYGZW[66+}qŻq05;&eJ7/|{۬gV6x6rw۳0S.Crt]yּqgkYM~,_[nkwHIr?8qǦM}Tؽ~C3VtFVGq6IV2 >7+Ǟ_S{3cJ'Ez-oI76k]RQux{+̏I# o֓ѧX3j-אepfX F՘]Y1J(f&qYJMHRY-Cvcu99⻔N=E)9e3"=K*/11bJt޼?#Wyi~nvr&KJ:6B>A(X\RwĤ>Am p1/)ꎶG] h<í&DWà |Ilqk&Hl'-?vhx$qۦoeNx`l"{WR0FshP ۾9>m@!TX1܂1iAKږ_2QLt-Zʷ]u<݇Yy.hт]Q$`Ҽ撗/S! jee,^%z`nXJQn*K/͑M得R<9nؿ P-AQz^Pj4 ֱh`"\5 |ݫLns.lɣ}A=[/ӡ e᝔%48;EԔS:mSK܉ľTk6M%bN7X k!*bL}4s~IhբgDUp]4/+st}lKreqG 2G<\4w73Vܳ%U3vW72eM-nV|?dz>/k~L#40ɺ =WdG]4Wf3] v6D%Lu Q|de,fKĠ\@rkv̩bReCf!w :!>\4|֔8I]hvHCP8{2Y}j\V@ԉ!gΑ'&O=N7)pv,"\ߗw)9oS+oHUEAT$KlOTBBe+N-:<@^Qk~t^ {,}ϸyM5IUD#>Uni[,wCp\4){eU)BcQ0'gA{[nS-`5XfPݤ.;͙)4kT5FG%2(<;rLr2CjSyIa|*L~잘~*`XTvq1"J/4ڟepҢj/D*̙ٞ 4Q#\A*l<ĂteA2˜e1j2;U*9](*w YA׸! Sm˦r;i0'R.<F!e0zT:g\ʤZ! auFSDExC2 Nq*W1Ԑupktdk?&7/3r[kRu! FLB#Ml;s+.-]ޭ8nL3F]q )0a b AC~_kP[@6.i{lUm#xs++$i-赠PvWa:Y:/VnJRSkIoBV?e?˼}Ɂ4J~E _@wm@،GAvA!2d/ @h_Yp?~"Z{|>`MQ.b*:`VgX{s#ZrqjVh xnRP{[`Fr| ܄גb*CNGބ"~El}⌑m5)?—Em}3Et;.Ft3&-Z,y&gah'+Q2+\a;!?"Qɒ huIeQpü/uܳ],b(*iOg 1>Ikt ;m8T%KI@-\>ۂBL>wWz6t> b8̤尙fDA61 Llix1+,Lr8U`yT\bOiP7T3h¦ʤG>$|Q@:K9肭H;IfFDؔ{\qٚ뷞;iPS~~08:# P *K¯{%81]|8pVA@kG mGt&L.eu]N-`͐@H^Nh5h+N 'G^sKz5-3ES:¾ Ҹ쭻5SWrKmr7z1<,#Y~9|IEM$Bb|KG3Rp}ɞCV;}3ߑ={'SvRr|K 3mHbk iILy]UԻĕAGB?Kx[g>P}ݙͤ0`z"0AUigN.zIr|@ qY ޕfmE+Ɯhh)Y䱧A$Գx j V .)l{Uemqyf!hs JQ< [B-8r GI8HN)Dop͉u/CR*4Aqȕ`S'FgxȌg <% py;2;%heIggV~j/&xY$i9G2(HƂߦ͒%YejWw?De/~ endstream endobj 194 0 obj <> stream x]j0 ~ CsA[Dz=c+a6Ast=fy%\Ulےqhi@dpq'oMp52նqA6AWyCގ<:>pEK҄1R-4/RBFmm.v+߻r+;AJ@x_SP o9 endstream endobj 195 0 obj <> stream x| \° &(n( "*%0( ٢QVV.٢V.Kbe{R.eR;a:ss=̽Ì@A1=wy{9&/wXVoˍO,x<'NL_Wtq? ;eЛ¾#M*Fyi.@ siŭ~BR }KKlb`}mYqQPagYQ_zB; U| ܫ:3x9wE.ʠ{7ۓ L3+W" b> 0 SST[6`3LBB#"(Bb(FJKʤP&DLG#̀PX *hۑs;T#V3 V~ZC3@fI,ww݈w=l8̆9s ,@\ ~"X#.hBl Yx9xyXK`=l@/H "/"~/Fč`CA54&Mq3lA[`+2lC--q;"} ki?쀝;arvnw눯o o" o!oK;9{]߅߃߇}Cc3 ')| !~#~_H◈W5 7p@Aăp>p;E(C<ǑsG~@~>pG''i?# Oip E#gWW 99sp^z/H?/"gKH_ˈ9&6!4YA/k'UlY wŮE{vW7! 'w7'ApnݳJ}6vWݠݳ/'{:o@٪)x_ø%S꠼qKݳXכOAj{w* ͧ {ur\Obݳ]J77BQ!{KUp/ %Ml.k'EEnpRDR_#x;)O[=7! A} .vro7o>Oy=gwIiPk8Hw_]J7! [z'{=[R%ek=oBNxP|=2gwkl'M= 7! <6ݳ]JD(qy!C?_G˂ ;igw5݄# 0荔~ÝyvՒp6v?f] rKA뛔;2"g#(0CrR*2dhB925zd;1 m"wmc Y3kK,RђH34tB&Gzq@fXF 0!f6R(f؆ז5fxΪ4MQ*g$ioa1+Je Ԥg4T/eH +4a6h46yMMT_lݸE E.Śb|/sxD6;_)i;&狶U;׆Q,(1/>q8N+l܂|ST]?&r 6'0MYB\Fԇm m 1/_f)ЧhƜ:1kMlLnf7wڙ0v15TfNe H3 =&D$_: ` S^b\)Q=i,\z#WJR?5omѶ("4\Sq+mR5f4dmaatoAl"m]|t+5k|&К5 5[V)#:}2وTŌBm3;+-ijZtʩi!&?9sq8ܦ.iUXuvj^qCL۠]]siQ`!̛بR|X,߬# r'oWpA^&pi {a]vC'r\Zi 2 :&NɪfZ1XB<S3XhL"1GpPE|4eOmZE1ࣗH`hBghJ$- n}@|mL ]z/Ue.r}ЪȪyUKoJ] 9o'oM-d.YѴCѴYTh*V4MR4 W4W4)Mኦ^ oRtS(UJR-wh-WӇ\(0ZQ_A戒`3a$ӶEBpeea ym3[Rm@tM=%%ȵq y-DA4nBς?sGnЁWt甙]>fER"q(qmf)!ͩ[uh-dUh6Hu[9PFzmƘniYTϢթf/ZJah}uT=8,Jl0*Yh S:}$ۥM dc _=M\:xo+Nfmt0~j'=޵nûhxNٰ[ 4<`7ƫZ1x D Xp/d!P cG;ms9@)go&a &<s>៖Y^קux @D2g?JiO}SQ,3r?\"N0N m)xǎF&@ `1jVF %ersfsdي,EӮ/m!Ci' =(\s,d0BFG!pƻ1|_/*eږ},eK3іОhtȃ` 0[  80?)"QM&iX22i!;['r璹q\Wʙ9+ٸfnw g~~LB` 64dz٪5mmSiT$-06bH'W@MZvhѣڎZehKߠߝ@P|H% h[̓qjɝd6YBV̻AԲ 5pqܝbnJHWŸg)m_ɷN$d ½BF(#|&ieem y_yE!W+O(`3ͰY@Ԥ^$'x9gn?i>")dK~E ɧ27hRB|~ ?*I.M!WXe{@/k6񜬑o% PKd-,z]}@% I8ׇۥxO)ݱ?b*O9{+{cbJo6w B҃[KƴBZI\zi=~em`'w&`0+:42)cS)^+Ḳ օ*\B0P>25%K}!e5W6##<#T"N@vK(Sۀz)pZ[|΁-$X `\pqz!e(LNNzi~}'%U-tȗצʸԸظTRGI3fL@ԥ=qqq: x}N7f F eB bU)1r՝*9(UDᤒ+dx/BJR *$EI.CZ8\vqiEv2Dٙ.@}xhCSRRlqzs~?}d?EJ K­VD4$KFc[wZ{>2EE6bh .vDy&ĩgPMH@ϞȞ=9MF 5!=5-҃ ^􏋏o!U:/狤/0/_GF8I/ K b#C}ڄ}a[\O1"%_2]jdj.i?%hɭa7)'_RO@.('(/'qo!a:WD%&jH.-D-ix>" Q[sl|DaQePcO;n=}< ==iuJ3_2vbdϗE)/)%w҉>cp_YuӦ|"'NgOhn-ĭy n|QUqUg{V TyGw*NB"{05Bgp8hu 9s`T^ӷGP_xRoR` v+̟8`f}֋`^S?,BC]/xv%1t@suK9wWn^LXs bML_7XQ8QjbZ:]X &cՄJuU3OoaWQ=TZ%b/lGMPLŊ(2<(>.a8%ZQ_a?LG٣X\#ұƌljU5]X[;V E7TV~b.0&:RQadpELr\J:VXD4(3'muEsuUq#R'ž1Oh2du8P^Sl,"}UeyG4V,W'-k^LWZmb~seڽcM8XAwZ g-,wn*tKTgU\cTMڦXnj81ќ.)3PwZw8dATC^X"'4'c:sJ(Fb~9wk; a3):|cq$:J46&BDN9C*xTC| {[JF|m-b_֣Eȣvا}nhꍽM(m5XUa3B xU~[,cQehUͮeXV+#mW3Ubơ<%L>#:,QƲ"epPzF5tFFg᳎Ybe<ҙXr'"'՟Va}㷷.bm jk1kÈ26%yٳ zѕ~1 LbZм]:K%$6>t2z6}0ѮJV6}u-M䘘a:6ތNWd_=RW j#,]wz'O1-̸/1ױ#v8,}h6z&-Y`Zi:A=i]{ YtU kW[SvoP/f,63N*ؾ63`nuHWh_rn@_8%:tq1r1jItsvϪcv2ڝ/yٞ)gTolFIvt7]j+wa{oӠ}5PMX|it|,VȪvw*{rIje7vf8elGmce޾CL+S1K<rѳ6#cr2v9' B0B1[:TT#a; ijo^y$֚>7~ :!x)jy!x)Ip:en<(^4 *W;^ӉcMǡ-,Ь 4x? sݵSw{㺪X 6V8$oYh]LǵU'r/nBnփ^IzKU je*9b<'h{Pӕ5!LJy/+kWTmkBmR6!91!qd,(jlW$s:zg/a위HmRf2ӳzzn5(yش &$k5vztQƣm =;[Ȁo |@468ùOWtUCNZ5tuvצ}:O;[emŬajM sጐ˛w |=gbsWpK:sFKʶ|2@t] Y'>gWhUgզ>#e+Z-/MLfS7ӝr8l5w>ҴG>)PaYrKQ︿6Arﺀ{׾{V\"jkKl8 -"I_v&m~g bt6PFfiݥKm{mvXmvԪ29Uub+ ;e2hJܘ2avvd{YK|q٪ .ZU S/pOǾ:^©?LnetmjӃ GNm?KC7Ȅۣ$T;2V=X~ݐGoy8y.v}=7Khdװ?}w-{2}i_)ur& әKhϲ.|j֭|O> cL~4?y r]iМ;2#<7~QJlmiJ}4Jm7<J|ãJXUeiO.m+0bc*oY_z\rz(b_cI/ktXXm}s0HπVZc-6Yi&%$K&cJL`$-- @ruyF>u猸#;{?<'}2EVYE#>KMF|3~Bncg }?'=W# :5-3#omKK}pxm¼qr\175i+V}ϻ/cز7܊-M+G%}J_v3k.o0,Vvm5_}36oƐ uV|;ޥ`˿D>왙']yCtn4"i"DdZ"OG jڇoHkuBzY㞩|zC'XwcIs).^>9끖=,(jĽ%ze?~In_H0«3Sə;P.ylϡq:~b/fX3rmX.BvYgؒ}4I^!Y!)ʚH%BN,E֬Y$EޡN=~~뺾%rK$WEy=|K߿oԣU*LR^.h@3cctí4 +b3 [PY_YbՋ n=K ^6--,TL4pG:$&/EL~ᅜta$/M+vLQZc7o{IU5z154Tc)//A96gnd2S ٚ3yy:ԦEhu!BGϘ,zz{m9!XAY(}7<-BEhĹCͱ|-7]f(OW(igL֭"zI_ayv7[ˌ޼nVY-ik`{(h`sL~ MeY"SIM" (G FZ ȄIHsLvFΎnEgbPFpYHo;BIG E\?;u $q~d!L%Oj!sA*Pe]1)b_Rf8>0Tʭ\'j28*>nK٣_XWԑei]H3_s8P~A]}I6\BÞ(7rVъd7};N3OGaNm!kŝ4=)QK$П11H¥Q$ !)%C8Hì%maҶH)-FX>YEFv7$/hD&9` ݡyh߁owa @?y"G Z_⯸SpTeHF*>剨UZ-AwXKXwSFf$Qod n)eձ}WIk)œt`n5Ru5OHx*ڲ?Z< P yTcTc 5Yfh~ʣ7)m$=IOT|M3t;u1W)Td Ձ{ˍFsy-aՉ˦wrUg-^OFR{ 0 ꒙ޏcp&m]pz(]@X#s"sT 4Cz xai1#h~ zG:"Δؒ9%:&pVfQiQ4f ҍR-B](]*p|V,n  KG(~Pve470 3rjvvD ['oVɣkGʜ9C/ˬYf/|Oh:m~FAh$"[lOD*Rr !B6 D}p3C^[^z`Ɠ.2m_PE.F]@9(]}J^, Wow9sřN;ҍʨP&j=F630< 1YH^^iTĻiKaYnvR~mia]ʉ?O[xr]6ou/ct\(0ÑJ}ssjW/]`W,:ζ85 +4kT*'Q(-+&y#DlU*@]Qu|WI"ЋkyЬBdpr:KqqxouvDH:rTGWi? W|cV@#5w!XzZrxi>*0ØI!fj7aqQ@~ᕡY%SB/Nj 3 t CIfX|>̹6ŋ+˜x^@hsׁЫ/I(A$vOjފ (^ 9܇@wZEtN[9{{CRЯ6grM&ӏ^KUMNxlSԀyNiUpN[T^}xB`>k;t9vl)NP`8{]ntڮE]/o1VWXM'tn!Ns$-$bmEfK[_}!Q+&PXpcp8U(Q.QDp5 XGa/,2kQ5Q=iW s,S-tE[#θSQNn^ d"BX%F:NY>&ᐭtJOKi#t[٪Y˸HKԛںbqnH[{)}f$~b3) a~O%-W-i)ՖdaMu?v{I§,4+ׅŒpF[-됤c$!^JLfuF >C'~4׻3xun]O8QdBi2koc.Yer,pָ˕Đ9Λp#-w6-ɣKȽ m/IZjE/=ȫ'(`h]'9Cj&ޙmrr lu!y%eѯ)bkSN/R"o#Yh&H.)ys lYޙR4u ^)&&xcN@W_K6¸Twr@ K:=eF"s۟0EW9$|}Ƃ\kr^ũ7Ӄw*;u7W߷lUwNȳj".t 4H_{38կzō6wlj"Ԉtϕlpr .¦A endstream endobj 196 0 obj [ 0[ 600] ] endobj 197 0 obj [ 278] endobj 198 0 obj <<732A60D82D639B4D98619884B3A712A8>] /Filter/FlateDecode/Length 453>> stream x5IOQ"AeF-(hEG eyyQBAA tnM\o?$果0c?< #L~˴h=aX'!"2$\mMdaᵋ$X-QG.Q)FW"0#u"]Ny+숕! fC<2*,508+DQhX88$@"@$C*A'!d2Np !r4<ȅ(B8p(+P Px*T5 P 5P >zuP m7: zn- w}0O!|Es|7h? cztJ-lcm endstream endobj xref 0 199 0000000042 65535 f 0000000017 00000 n 0000000125 00000 n 0000000181 00000 n 0000000638 00000 n 0000006733 00000 n 0000006909 00000 n 0000007158 00000 n 0000007211 00000 n 0000007264 00000 n 0000007434 00000 n 0000007675 00000 n 0000007808 00000 n 0000007838 00000 n 0000007999 00000 n 0000008073 00000 n 0000008314 00000 n 0000008465 00000 n 0000008638 00000 n 0000008875 00000 n 0000009074 00000 n 0000015980 00000 n 0000016156 00000 n 0000016402 00000 n 0000016529 00000 n 0000016559 00000 n 0000016714 00000 n 0000016788 00000 n 0000017021 00000 n 0000017184 00000 n 0000017411 00000 n 0000027934 00000 n 0000028133 00000 n 0000030171 00000 n 0000030370 00000 n 0000031871 00000 n 0000032070 00000 n 0000032944 00000 n 0000033143 00000 n 0000034055 00000 n 0000034254 00000 n 0000035681 00000 n 0000000043 65535 f 0000000044 65535 f 0000000045 65535 f 0000000046 65535 f 0000000047 65535 f 0000000048 65535 f 0000000049 65535 f 0000000050 65535 f 0000000051 65535 f 0000000052 65535 f 0000000053 65535 f 0000000054 65535 f 0000000055 65535 f 0000000056 65535 f 0000000057 65535 f 0000000058 65535 f 0000000059 65535 f 0000000060 65535 f 0000000061 65535 f 0000000062 65535 f 0000000063 65535 f 0000000064 65535 f 0000000065 65535 f 0000000066 65535 f 0000000067 65535 f 0000000068 65535 f 0000000069 65535 f 0000000070 65535 f 0000000071 65535 f 0000000072 65535 f 0000000073 65535 f 0000000074 65535 f 0000000075 65535 f 0000000076 65535 f 0000000077 65535 f 0000000078 65535 f 0000000079 65535 f 0000000080 65535 f 0000000081 65535 f 0000000082 65535 f 0000000083 65535 f 0000000084 65535 f 0000000085 65535 f 0000000086 65535 f 0000000087 65535 f 0000000088 65535 f 0000000089 65535 f 0000000090 65535 f 0000000091 65535 f 0000000092 65535 f 0000000093 65535 f 0000000094 65535 f 0000000095 65535 f 0000000096 65535 f 0000000097 65535 f 0000000098 65535 f 0000000099 65535 f 0000000100 65535 f 0000000101 65535 f 0000000102 65535 f 0000000103 65535 f 0000000104 65535 f 0000000105 65535 f 0000000106 65535 f 0000000107 65535 f 0000000108 65535 f 0000000109 65535 f 0000000110 65535 f 0000000111 65535 f 0000000112 65535 f 0000000113 65535 f 0000000114 65535 f 0000000115 65535 f 0000000116 65535 f 0000000117 65535 f 0000000118 65535 f 0000000119 65535 f 0000000120 65535 f 0000000121 65535 f 0000000122 65535 f 0000000123 65535 f 0000000124 65535 f 0000000125 65535 f 0000000126 65535 f 0000000127 65535 f 0000000128 65535 f 0000000129 65535 f 0000000130 65535 f 0000000131 65535 f 0000000132 65535 f 0000000133 65535 f 0000000134 65535 f 0000000135 65535 f 0000000136 65535 f 0000000137 65535 f 0000000138 65535 f 0000000139 65535 f 0000000140 65535 f 0000000141 65535 f 0000000142 65535 f 0000000143 65535 f 0000000144 65535 f 0000000145 65535 f 0000000146 65535 f 0000000147 65535 f 0000000148 65535 f 0000000149 65535 f 0000000150 65535 f 0000000151 65535 f 0000000152 65535 f 0000000153 65535 f 0000000154 65535 f 0000000155 65535 f 0000000156 65535 f 0000000157 65535 f 0000000158 65535 f 0000000159 65535 f 0000000160 65535 f 0000000161 65535 f 0000000162 65535 f 0000000163 65535 f 0000000164 65535 f 0000000165 65535 f 0000000166 65535 f 0000000167 65535 f 0000000168 65535 f 0000000169 65535 f 0000000170 65535 f 0000000171 65535 f 0000000172 65535 f 0000000173 65535 f 0000000174 65535 f 0000000175 65535 f 0000000176 65535 f 0000000177 65535 f 0000000178 65535 f 0000000179 65535 f 0000000180 65535 f 0000000181 65535 f 0000000182 65535 f 0000000183 65535 f 0000000184 65535 f 0000000000 65535 f 0000038367 00000 n 0000038617 00000 n 0000152254 00000 n 0000152631 00000 n 0000334044 00000 n 0000334607 00000 n 0000334931 00000 n 0000334959 00000 n 0000335221 00000 n 0000490334 00000 n 0000490630 00000 n 0000503600 00000 n 0000503633 00000 n 0000503661 00000 n trailer <<732A60D82D639B4D98619884B3A712A8>] >> startxref 504317 %%EOF xref 0 0 trailer <<732A60D82D639B4D98619884B3A712A8>] /Prev 504317/XRefStm 503661>> startxref 508457 %%EOF